Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524906728:

Variant ID: vg0524906728 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24906728
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TGGACGATAGTGGTAAATTAAAGAATAAGTCATACTTGTGCTTCTTCTATTTGGTGAGCAATAAGCTAGCTAGCCATGATCATCAAATAGCCATCAGCAA[C/T]
GCTATTCTACTCAGCTATACCAAAAATACCCCTTGACACCCTCTACCTAGTGCACAGCAATGGCACATGCATTTTTAAGTTGTTTTGGTCTTAATTTGTT

Reverse complement sequence

AACAAATTAAGACCAAAACAACTTAAAAATGCATGTGCCATTGCTGTGCACTAGGTAGAGGGTGTCAAGGGGTATTTTTGGTATAGCTGAGTAGAATAGC[G/A]
TTGCTGATGGCTATTTGATGATCATGGCTAGCTAGCTTATTGCTCACCAAATAGAAGAAGCACAAGTATGACTTATTCTTTAATTTACCACTATCGTCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	9.40%	0.28%	0.00%	NA
All Indica	2759	94.60%	5.30%	0.14%	0.00%	NA
All Japonica	1512	80.40%	19.00%	0.60%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	75.30%	23.90%	0.86%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	4.20%	0.00%	0.00%	NA
Temperate Japonica	767	96.10%	3.30%	0.65%	0.00%	NA
Tropical Japonica	504	54.60%	44.80%	0.60%	0.00%	NA
Japonica Intermediate	241	84.20%	15.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524906728	C -> T	LOC_Os05g42436.1	upstream_gene_variant ; 2602.0bp to feature; MODIFIER	silent_mutation	Average:53.078; most accessible tissue: Callus, score: 88.597	N	N	N	N
vg0524906728	C -> T	LOC_Os05g42428-LOC_Os05g42436	intergenic_region ; MODIFIER	silent_mutation	Average:53.078; most accessible tissue: Callus, score: 88.597	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524906728	NA	1.18E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	NA	2.14E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	NA	1.52E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	NA	8.34E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.54E-11	NA	mr1889	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	3.45E-13	3.77E-26	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.00E-07	NA	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	2.89E-12	6.14E-25	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.74E-10	4.59E-27	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	9.87E-14	1.48E-26	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.26E-09	NA	mr1907	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.76E-15	1.04E-36	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	2.28E-07	NA	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	3.00E-16	3.95E-33	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	6.89E-08	NA	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.22E-12	8.64E-25	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	NA	1.35E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	NA	6.60E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	NA	1.49E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	3.52E-06	NA	mr1889_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	3.22E-06	1.58E-20	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.07E-06	1.07E-18	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	1.55E-06	NA	mr1907_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	3.60E-11	1.69E-30	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524906728	9.81E-11	1.52E-28	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251