\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524882575:

Variant ID: vg0524882575 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24882575
Reference Allele: TAlternative Allele: A,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.07, A: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTGGGTGATATTTTTGCATGCGGACCACTTAAGGAGCCGCATGCAAAAATCTATTTTCGCATGCGGACAACTTAAGGAGCCGCATGCAAAATAGTTA[T/A,C]
TAAAAAATAATTTAAAAATATGAGAACTTGGAATTAAATTTTTTAATACTAAATGAACTCAAATGAAAACATTGCCAAAAACAAAGTAGTAGAACTCGTT

Reverse complement sequence

AACGAGTTCTACTACTTTGTTTTTGGCAATGTTTTCATTTGAGTTCATTTAGTATTAAAAAATTTAATTCCAAGTTCTCATATTTTTAAATTATTTTTTA[A/T,G]
TAACTATTTTGCATGCGGCTCCTTAAGTTGTCCGCATGCGAAAATAGATTTTTGCATGCGGCTCCTTAAGTGGTCCGCATGCAAAAATATCACCCAAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 45.10% 2.24% 0.40% C: 0.15%
All Indica  2759 85.90% 9.90% 3.44% 0.65% C: 0.04%
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 14.10% 81.40% 2.60% 0.00% C: 1.86%
Indica I  595 93.30% 1.30% 4.54% 0.84% NA
Indica II  465 62.40% 31.80% 4.09% 1.72% NA
Indica III  913 95.60% 2.40% 1.86% 0.11% NA
Indica Intermediate  786 83.10% 12.20% 4.07% 0.51% C: 0.13%
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 95.80% 1.04% 0.00% C: 1.04%
Intermediate  90 40.00% 55.60% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524882575 T -> DEL N N silent_mutation Average:31.653; most accessible tissue: Callus, score: 71.376 N N N N
vg0524882575 T -> C LOC_Os05g42428.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:31.653; most accessible tissue: Callus, score: 71.376 N N N N
vg0524882575 T -> C LOC_Os05g42428-LOC_Os05g42436 intergenic_region ; MODIFIER silent_mutation Average:31.653; most accessible tissue: Callus, score: 71.376 N N N N
vg0524882575 T -> A LOC_Os05g42428.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:31.653; most accessible tissue: Callus, score: 71.376 N N N N
vg0524882575 T -> A LOC_Os05g42428-LOC_Os05g42436 intergenic_region ; MODIFIER silent_mutation Average:31.653; most accessible tissue: Callus, score: 71.376 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524882575 NA 2.15E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.89E-46 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 4.88E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.23E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.81E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 7.34E-09 1.05E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 9.43E-11 2.52E-25 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 3.35E-08 NA mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 3.41E-08 1.29E-23 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 1.02E-11 2.67E-27 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 1.58E-11 4.91E-26 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 1.64E-11 8.92E-79 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 1.00E-12 1.00E-36 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 1.26E-09 NA mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 7.91E-11 3.11E-29 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 3.33E-09 NA mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 1.76E-09 4.80E-23 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 2.55E-60 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.04E-23 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 4.49E-06 mr1253_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 6.68E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 2.24E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 5.39E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.60E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 2.20E-18 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.18E-16 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 6.40E-06 7.14E-27 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 7.67E-08 1.78E-25 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524882575 NA 1.93E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251