\
| Variant ID: vg0524832921 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24832921 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, C: 0.42, others allele: 0.00, population size: 99. )
CTCTCGCACTATTCATTTGTGGACATACTACATGATATGTATATGGATGGATTGTATGATAATTAACTAGCAATAGTTTCTTATTTACTCGAGAAAAAAA[T/C]
ATGATTCAAAAGTGGTAAGTATTTAATCCATCTCCTACTCAAATGTTTACGAATGGTTTTTTAAGATACCGTAAGAAAAATAGAAGCCTTAAATTATTAT
ATAATAATTTAAGGCTTCTATTTTTCTTACGGTATCTTAAAAAACCATTCGTAAACATTTGAGTAGGAGATGGATTAAATACTTACCACTTTTGAATCAT[A/G]
TTTTTTTCTCGAGTAAATAAGAAACTATTGCTAGTTAATTATCATACAATCCATCCATATACATATCATGTAGTATGTCCACAAATGAATAGTGCGAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.20% | 39.50% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 92.40% | 7.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 69.00% | 30.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 99.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 43.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524832921 | T -> C | LOC_Os05g42390.1 | upstream_gene_variant ; 269.0bp to feature; MODIFIER | silent_mutation | Average:20.103; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0524832921 | T -> C | LOC_Os05g42400.1 | downstream_gene_variant ; 2506.0bp to feature; MODIFIER | silent_mutation | Average:20.103; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0524832921 | T -> C | LOC_Os05g42380-LOC_Os05g42390 | intergenic_region ; MODIFIER | silent_mutation | Average:20.103; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524832921 | NA | 8.66E-11 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 3.32E-08 | 3.72E-64 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 1.37E-12 | 6.38E-28 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 1.24E-07 | 7.65E-77 | mr1896 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 2.37E-10 | 7.95E-25 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 3.61E-11 | 4.70E-40 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 2.03E-12 | 2.71E-26 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 2.49E-09 | 2.79E-93 | mr1907 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 2.62E-13 | 3.01E-36 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 3.23E-10 | 2.54E-86 | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 3.39E-14 | 3.37E-32 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 1.94E-08 | 1.91E-61 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 2.25E-10 | 6.39E-24 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 1.20E-06 | NA | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 1.26E-14 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 3.81E-06 | NA | mr1253_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 6.48E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 2.87E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 2.22E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 9.15E-08 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 4.00E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 5.42E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 3.06E-09 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 9.15E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 7.39E-06 | 1.92E-21 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 3.83E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 6.77E-65 | mr1896_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 1.12E-06 | 5.48E-20 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 4.52E-10 | 1.68E-31 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | NA | 4.93E-23 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 6.32E-06 | 4.40E-81 | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524832921 | 1.96E-11 | 4.45E-30 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |