Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524793384:

Variant ID: vg0524793384 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24793384
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGCCCTGTTACTGACTCTCTCAAACAATCTTTCCTTTCTGAATTGAGCTGGCATTTACAAGACTCTCCTCACCCTTTTATTATTGGGGGTGACTTCAA[C/A]
CCATACAGATTTGCTAAGGAGAAATCTAACAGTAACCTTGATTTTAGAGCTATGGACCTCTTTAATTCTTTTATTCTTGACATGGATTTGAGTGAACTAC

Reverse complement sequence

GTAGTTCACTCAAATCCATGTCAAGAATAAAAGAATTAAAGAGGTCCATAGCTCTAAAATCAAGGTTACTGTTAGATTTCTCCTTAGCAAATCTGTATGG[G/T]
TTGAAGTCACCCCCAATAATAAAAGGGTGAGGAGAGTCTTGTAAATGCCAGCTCAATTCAGAAAGGAAAGATTGTTTGAGAGAGTCAGTAACAGGGCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.80%	3.70%	0.42%	0.00%	NA
All Indica	2759	94.30%	5.30%	0.43%	0.00%	NA
All Japonica	1512	97.60%	1.90%	0.46%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	72.70%	24.70%	2.58%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	3.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	94.20%	4.80%	0.99%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524793384	C -> A	LOC_Os05g42370.1	missense_variant ; p.Asn572Lys; MODERATE	nonsynonymous_codon	Average:40.726; most accessible tissue: Zhenshan97 panicle, score: 54.901	unknown	unknown	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524793384	1.20E-10	NA	mr1889	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	2.21E-13	2.30E-24	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	4.62E-13	NA	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	9.75E-14	4.05E-25	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	6.37E-18	NA	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	1.69E-15	1.64E-27	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	1.90E-15	NA	mr1907	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	2.42E-15	2.20E-35	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	4.96E-16	NA	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	3.85E-16	6.81E-32	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	4.66E-13	NA	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	3.50E-12	1.76E-23	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	1.44E-09	NA	mr1889_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	2.68E-09	4.30E-23	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	4.17E-12	NA	mr1896_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	4.57E-11	3.07E-21	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	1.61E-16	NA	mr1907_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	3.03E-16	3.24E-33	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	1.76E-16	NA	mr1934_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524793384	1.07E-15	1.00E-32	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251