\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524719942:

Variant ID: vg0524719942 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24719942
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTTTCTTATGTACTGATATGGACCTTAACCAAAACATATATCTCTTTATGTTTCCTGCTTACCACTTTTTGTTACAAATTATGGCTCTCTTCGTGT[T/A]
TAAAAAAATTATGGCTCTCTTTACATGGAGGAATGCCCTTCCAATCAATATAAGCAAACCAATCGCTGAAGATGCATCGACCAATATATATTAGAGCACA

Reverse complement sequence

TGTGCTCTAATATATATTGGTCGATGCATCTTCAGCGATTGGTTTGCTTATATTGATTGGAAGGGCATTCCTCCATGTAAAGAGAGCCATAATTTTTTTA[A/T]
ACACGAAGAGAGCCATAATTTGTAACAAAAAGTGGTAAGCAGGAAACATAAAGAGATATATGTTTTGGTTAAGGTCCATATCAGTACATAAGAAAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.30% 0.08% 0.40% NA
All Indica  2759 91.60% 7.90% 0.04% 0.47% NA
All Japonica  1512 0.70% 98.90% 0.20% 0.26% NA
Aus  269 27.50% 72.50% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.00% 0.50% NA
Indica II  465 68.20% 31.20% 0.22% 0.43% NA
Indica III  913 99.00% 0.80% 0.00% 0.22% NA
Indica Intermediate  786 91.20% 8.00% 0.00% 0.76% NA
Temperate Japonica  767 0.40% 99.30% 0.00% 0.26% NA
Tropical Japonica  504 1.40% 98.20% 0.40% 0.00% NA
Japonica Intermediate  241 0.00% 98.80% 0.41% 0.83% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524719942 T -> DEL N N silent_mutation Average:28.297; most accessible tissue: Callus, score: 60.369 N N N N
vg0524719942 T -> A LOC_Os05g42270.1 upstream_gene_variant ; 4382.0bp to feature; MODIFIER silent_mutation Average:28.297; most accessible tissue: Callus, score: 60.369 N N N N
vg0524719942 T -> A LOC_Os05g42250.1 downstream_gene_variant ; 3200.0bp to feature; MODIFIER silent_mutation Average:28.297; most accessible tissue: Callus, score: 60.369 N N N N
vg0524719942 T -> A LOC_Os05g42260.1 downstream_gene_variant ; 928.0bp to feature; MODIFIER silent_mutation Average:28.297; most accessible tissue: Callus, score: 60.369 N N N N
vg0524719942 T -> A LOC_Os05g42250-LOC_Os05g42260 intergenic_region ; MODIFIER silent_mutation Average:28.297; most accessible tissue: Callus, score: 60.369 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524719942 NA 4.98E-16 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 7.96E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 1.45E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 5.27E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 1.45E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.46E-06 NA mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.38E-09 3.61E-57 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 3.33E-15 3.04E-30 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.93E-13 5.73E-73 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 4.34E-18 3.33E-32 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.75E-17 1.80E-33 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 4.84E-21 5.54E-35 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.05E-16 1.95E-91 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.88E-23 1.34E-49 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 2.58E-14 NA mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 9.93E-20 3.15E-39 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 3.73E-11 NA mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 2.15E-14 2.00E-29 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 8.06E-09 9.75E-60 mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 4.07E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 1.26E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 9.77E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 2.96E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 9.18E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 2.46E-07 2.07E-11 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 1.95E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 5.98E-08 1.58E-70 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.24E-10 8.57E-28 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 3.38E-07 7.08E-67 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 8.96E-10 3.59E-24 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 4.23E-14 3.72E-99 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 5.27E-16 5.40E-38 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 1.17E-10 NA mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 3.68E-15 2.15E-34 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524719942 NA 1.23E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251