\
| Variant ID: vg0524701771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24701771 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 218. )
AAAATAGTCACCATGTATTTACAATGTAAGTGTCTAAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTTTCAAAATTACATATGTAAGTTTAAT[G/A]
TAATTACAATGTAAGTGCAAGACAACGTCTATATTTTGCATTGTAGACATTACATATATTTATATACTATACAGATACATATGAGTAGAACCATCAAAAG
CTTTTGATGGTTCTACTCATATGTATCTGTATAGTATATAAATATATGTAATGTCTACAATGCAAAATATAGACGTTGTCTTGCACTTACATTGTAATTA[C/T]
ATTAAACTTACATATGTAATTTTGAAACTTACATTGTAAATACACTAAAATTACATATGTAATTTAGACACTTACATTGTAAATACATGGTGACTATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 2.60% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 4.30% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.70% | 1.18% | 0.00% | NA |
| Indica II | 465 | 92.30% | 7.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 3.10% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524701771 | G -> A | LOC_Os05g42230.1 | downstream_gene_variant ; 4608.0bp to feature; MODIFIER | silent_mutation | Average:34.884; most accessible tissue: Callus, score: 53.724 | N | N | N | N |
| vg0524701771 | G -> A | LOC_Os05g42240.1 | downstream_gene_variant ; 609.0bp to feature; MODIFIER | silent_mutation | Average:34.884; most accessible tissue: Callus, score: 53.724 | N | N | N | N |
| vg0524701771 | G -> A | LOC_Os05g42230-LOC_Os05g42240 | intergenic_region ; MODIFIER | silent_mutation | Average:34.884; most accessible tissue: Callus, score: 53.724 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524701771 | NA | 1.88E-12 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 2.44E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 2.02E-12 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 5.33E-08 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 6.77E-09 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 3.82E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 1.68E-06 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 4.71E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 2.73E-08 | mr1408_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 2.25E-11 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524701771 | NA | 4.79E-06 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |