\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524701771:

Variant ID: vg0524701771 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24701771
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATAGTCACCATGTATTTACAATGTAAGTGTCTAAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTTTCAAAATTACATATGTAAGTTTAAT[G/A]
TAATTACAATGTAAGTGCAAGACAACGTCTATATTTTGCATTGTAGACATTACATATATTTATATACTATACAGATACATATGAGTAGAACCATCAAAAG

Reverse complement sequence

CTTTTGATGGTTCTACTCATATGTATCTGTATAGTATATAAATATATGTAATGTCTACAATGCAAAATATAGACGTTGTCTTGCACTTACATTGTAATTA[C/T]
ATTAAACTTACATATGTAATTTTGAAACTTACATTGTAAATACACTAAAATTACATATGTAATTTAGACACTTACATTGTAAATACATGGTGACTATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.60% 0.49% 0.00% NA
All Indica  2759 94.90% 4.30% 0.80% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 0.70% 1.18% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 93.40% 6.20% 0.33% 0.00% NA
Indica Intermediate  786 95.50% 3.10% 1.40% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524701771 G -> A LOC_Os05g42230.1 downstream_gene_variant ; 4608.0bp to feature; MODIFIER silent_mutation Average:34.884; most accessible tissue: Callus, score: 53.724 N N N N
vg0524701771 G -> A LOC_Os05g42240.1 downstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:34.884; most accessible tissue: Callus, score: 53.724 N N N N
vg0524701771 G -> A LOC_Os05g42230-LOC_Os05g42240 intergenic_region ; MODIFIER silent_mutation Average:34.884; most accessible tissue: Callus, score: 53.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524701771 NA 1.88E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 2.44E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 2.02E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 5.33E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 6.77E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 3.82E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 1.68E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 4.71E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 2.73E-08 mr1408_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 2.25E-11 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524701771 NA 4.79E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251