Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524622529:

Variant ID: vg0524622529 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24622529
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCATTATAATTTTGCAAAATTTAAGATATGCCATCCTGACCCACATGTCATTGACTCATGTGGGTCCTACATGTCATTGAGATACCGATGACATATCT[C/T]
AAACTTTACAAAATTATAATGGCATGGTTCTAATTTACCTTTTTTATATCACATGAATGCATGAACTCAAAATCATTGCAGTTCACTGCAACATCTACGG

Reverse complement sequence

CCGTAGATGTTGCAGTGAACTGCAATGATTTTGAGTTCATGCATTCATGTGATATAAAAAAGGTAAATTAGAACCATGCCATTATAATTTTGTAAAGTTT[G/A]
AGATATGTCATCGGTATCTCAATGACATGTAGGACCCACATGAGTCAATGACATGTGGGTCAGGATGGCATATCTTAAATTTTGCAAAATTATAATGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	8.00%	0.00%	0.00%	NA
All Indica	2759	94.10%	5.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	24.90%	75.10%	0.00%	0.00%	NA
Indica I	595	85.40%	14.60%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.10%	5.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524622529	C -> T	LOC_Os05g42120.1	upstream_gene_variant ; 4692.0bp to feature; MODIFIER	silent_mutation	Average:53.162; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0524622529	C -> T	LOC_Os05g42080.1	downstream_gene_variant ; 3692.0bp to feature; MODIFIER	silent_mutation	Average:53.162; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0524622529	C -> T	LOC_Os05g42100.1	downstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:53.162; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0524622529	C -> T	LOC_Os05g42110.1	downstream_gene_variant ; 3817.0bp to feature; MODIFIER	silent_mutation	Average:53.162; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0524622529	C -> T	LOC_Os05g42080-LOC_Os05g42100	intergenic_region ; MODIFIER	silent_mutation	Average:53.162; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524622529	NA	2.39E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	6.88E-10	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.38E-08	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	5.33E-10	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	8.24E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.27E-09	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	8.20E-08	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	2.59E-07	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	2.09E-08	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.60E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	6.55E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	9.07E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.52E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	7.52E-09	mr1006_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	6.78E-07	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	6.64E-10	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.94E-06	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.19E-09	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	3.39E-08	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	3.20E-07	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.94E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	2.20E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.98E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	4.64E-08	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524622529	NA	1.51E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251