\
| Variant ID: vg0524619386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24619386 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )
CTCACTGCAACATCTACTGATCAATTCGCTCAGATGCAGCCTGAACCACTTCCCAAACTGTAGCAGTTCACTGAAACATAGGCTATGTTTAGTTCGTACT[A/G]
AAATTGAAAGTTTGGTTAAAATTAAAACGATTTGATGGAAAAAGTGAAAGTTAATGTGTAGAAAAGTTTTGATGTGATGGAAAAGTTGGAAGTTTGAAAA
TTTTCAAACTTCCAACTTTTCCATCACATCAAAACTTTTCTACACATTAACTTTCACTTTTTCCATCAAATCGTTTTAATTTTAACCAAACTTTCAATTT[T/C]
AGTACGAACTAAACATAGCCTATGTTTCAGTGAACTGCTACAGTTTGGGAAGTGGTTCAGGCTGCATCTGAGCGAATTGATCAGTAGATGTTGCAGTGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 2.70% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 4.60% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 92.00% | 7.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 93.10% | 6.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 3.70% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524619386 | A -> G | LOC_Os05g42070.1 | downstream_gene_variant ; 2021.0bp to feature; MODIFIER | silent_mutation | Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0524619386 | A -> G | LOC_Os05g42080.1 | downstream_gene_variant ; 549.0bp to feature; MODIFIER | silent_mutation | Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0524619386 | A -> G | LOC_Os05g42100.1 | downstream_gene_variant ; 3927.0bp to feature; MODIFIER | silent_mutation | Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0524619386 | A -> G | LOC_Os05g42080-LOC_Os05g42100 | intergenic_region ; MODIFIER | silent_mutation | Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524619386 | NA | 2.28E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 8.76E-12 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 6.65E-09 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 2.34E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 2.81E-09 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 9.12E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 1.25E-08 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | 1.92E-08 | 5.40E-11 | mr1935 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 7.90E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 4.49E-13 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524619386 | NA | 2.49E-06 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |