\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524619386:

Variant ID: vg0524619386 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24619386
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CTCACTGCAACATCTACTGATCAATTCGCTCAGATGCAGCCTGAACCACTTCCCAAACTGTAGCAGTTCACTGAAACATAGGCTATGTTTAGTTCGTACT[A/G]
AAATTGAAAGTTTGGTTAAAATTAAAACGATTTGATGGAAAAAGTGAAAGTTAATGTGTAGAAAAGTTTTGATGTGATGGAAAAGTTGGAAGTTTGAAAA

Reverse complement sequence

TTTTCAAACTTCCAACTTTTCCATCACATCAAAACTTTTCTACACATTAACTTTCACTTTTTCCATCAAATCGTTTTAATTTTAACCAAACTTTCAATTT[T/C]
AGTACGAACTAAACATAGCCTATGTTTCAGTGAACTGCTACAGTTTGGGAAGTGGTTCAGGCTGCATCTGAGCGAATTGATCAGTAGATGTTGCAGTGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.70% 0.36% 0.00% NA
All Indica  2759 94.80% 4.60% 0.62% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.70% 0.67% 0.00% NA
Indica II  465 92.00% 7.30% 0.65% 0.00% NA
Indica III  913 93.10% 6.60% 0.33% 0.00% NA
Indica Intermediate  786 95.40% 3.70% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524619386 A -> G LOC_Os05g42070.1 downstream_gene_variant ; 2021.0bp to feature; MODIFIER silent_mutation Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0524619386 A -> G LOC_Os05g42080.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0524619386 A -> G LOC_Os05g42100.1 downstream_gene_variant ; 3927.0bp to feature; MODIFIER silent_mutation Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0524619386 A -> G LOC_Os05g42080-LOC_Os05g42100 intergenic_region ; MODIFIER silent_mutation Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524619386 NA 2.28E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 8.76E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 6.65E-09 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 2.34E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 2.81E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 9.12E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 1.25E-08 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 1.92E-08 5.40E-11 mr1935 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 7.90E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 4.49E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386 NA 2.49E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251