Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524619386:

Variant ID: vg0524619386 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24619386
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CTCACTGCAACATCTACTGATCAATTCGCTCAGATGCAGCCTGAACCACTTCCCAAACTGTAGCAGTTCACTGAAACATAGGCTATGTTTAGTTCGTACT[A/G]
AAATTGAAAGTTTGGTTAAAATTAAAACGATTTGATGGAAAAAGTGAAAGTTAATGTGTAGAAAAGTTTTGATGTGATGGAAAAGTTGGAAGTTTGAAAA

Reverse complement sequence

TTTTCAAACTTCCAACTTTTCCATCACATCAAAACTTTTCTACACATTAACTTTCACTTTTTCCATCAAATCGTTTTAATTTTAACCAAACTTTCAATTT[T/C]
AGTACGAACTAAACATAGCCTATGTTTCAGTGAACTGCTACAGTTTGGGAAGTGGTTCAGGCTGCATCTGAGCGAATTGATCAGTAGATGTTGCAGTGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	2.70%	0.36%	0.00%	NA
All Indica	2759	94.80%	4.60%	0.62%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.70%	0.67%	0.00%	NA
Indica II	465	92.00%	7.30%	0.65%	0.00%	NA
Indica III	913	93.10%	6.60%	0.33%	0.00%	NA
Indica Intermediate	786	95.40%	3.70%	0.89%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524619386	A -> G	LOC_Os05g42070.1	downstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0524619386	A -> G	LOC_Os05g42080.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0524619386	A -> G	LOC_Os05g42100.1	downstream_gene_variant ; 3927.0bp to feature; MODIFIER	silent_mutation	Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0524619386	A -> G	LOC_Os05g42080-LOC_Os05g42100	intergenic_region ; MODIFIER	silent_mutation	Average:47.656; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524619386	NA	2.28E-10	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	8.76E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	6.65E-09	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	2.34E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	2.81E-09	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	9.12E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	1.25E-08	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	1.92E-08	5.40E-11	mr1935	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	7.90E-13	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	4.49E-13	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524619386	NA	2.49E-06	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251