\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524611484:

Variant ID: vg0524611484 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24611484
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAGAACAAAAAGCTAAGGGCGTCTTTGAATCGTAAGAATGAAAAAATGTAGGATTTTGATAGAAATGTAAGTGTAAAACAGAGGATTGCAAAACACAG[G/T]
AATGACCGTTTGATTGGACCGCAGGAAAAACACAGGAATTAGAGGAGAGATAAAGACTCAAAGGAAAGTTTCCATGAGGTTCTACCTCATGTTAGAATTC

Reverse complement sequence

GAATTCTAACATGAGGTAGAACCTCATGGAAACTTTCCTTTGAGTCTTTATCTCTCCTCTAATTCCTGTGTTTTTCCTGCGGTCCAATCAAACGGTCATT[C/A]
CTGTGTTTTGCAATCCTCTGTTTTACACTTACATTTCTATCAAAATCCTACATTTTTTCATTCTTACGATTCAAAGACGCCCTTAGCTTTTTGTTCTTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.30% 0.28% 0.36% NA
All Indica  2759 92.50% 7.00% 0.14% 0.36% NA
All Japonica  1512 0.70% 98.70% 0.20% 0.40% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.00% 0.34% NA
Indica II  465 68.00% 31.20% 0.22% 0.65% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 93.80% 5.50% 0.25% 0.51% NA
Temperate Japonica  767 0.30% 99.30% 0.13% 0.26% NA
Tropical Japonica  504 1.60% 97.80% 0.40% 0.20% NA
Japonica Intermediate  241 0.40% 98.30% 0.00% 1.24% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 52.20% 41.10% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524611484 G -> T LOC_Os05g42060.1 upstream_gene_variant ; 271.0bp to feature; MODIFIER silent_mutation Average:41.361; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0524611484 G -> T LOC_Os05g42070.1 upstream_gene_variant ; 4720.0bp to feature; MODIFIER silent_mutation Average:41.361; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0524611484 G -> T LOC_Os05g42040.1 downstream_gene_variant ; 3556.0bp to feature; MODIFIER silent_mutation Average:41.361; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0524611484 G -> T LOC_Os05g42040-LOC_Os05g42060 intergenic_region ; MODIFIER silent_mutation Average:41.361; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0524611484 G -> DEL N N silent_mutation Average:41.361; most accessible tissue: Minghui63 root, score: 69.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524611484 NA 7.78E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.28E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.66E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.16E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 8.27E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 3.07E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 8.72E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 2.33E-08 3.46E-66 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.53E-09 2.86E-22 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 2.22E-10 1.41E-86 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 1.83E-11 2.52E-24 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.24E-10 4.44E-45 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 1.51E-07 1.21E-20 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.29E-19 2.85E-108 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.84E-18 6.37E-38 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.16E-13 1.09E-98 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 4.97E-12 1.13E-28 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 4.12E-11 3.36E-75 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 2.83E-10 2.65E-22 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 7.64E-19 mr1162_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 7.64E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 4.27E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 3.64E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.57E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.34E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 2.90E-19 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 8.71E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 4.53E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 3.58E-68 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.15E-06 4.16E-18 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 5.85E-13 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.45E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 NA 1.43E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 2.55E-07 4.45E-71 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 4.05E-08 6.43E-19 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 1.75E-09 3.81E-96 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 1.77E-10 1.12E-25 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 1.89E-08 1.11E-87 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524611484 3.09E-09 9.27E-23 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251