| Variant ID: vg0524596703 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 24596703 |
| Reference Allele: A | Alternative Allele: G,AACGGATG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 104. )
TCAGTTCAATGAAATCAGTATATTGACTTGGTTTGTAATTTGAAGCTTTTAGGGGTAGTTTGGATATAGGGACTAAACTTTAGTCTATGTTACATCGGAT[A/G,AACGGATG]
TTTGATATTAATTTATAATATTAAATATAAGCTAACTATAAAACTAATTACATAGATAGATGCTAATTTGCGAGATGAATCTATTAAGCCAAATTAATCC
GGATTAATTTGGCTTAATAGATTCATCTCGCAAATTAGCATCTATCTATGTAATTAGTTTTATAGTTAGCTTATATTTAATATTATAAATTAATATCAAA[T/C,CATCCGTT]
ATCCGATGTAACATAGACTAAAGTTTAGTCCCTATATCCAAACTACCCCTAAAAGCTTCAAATTACAAACCAAGTCAATATACTGATTTCATTGAACTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 38.10% | 0.38% | 0.00% | AACGGATG: 0.02% |
| All Indica | 2759 | 92.80% | 6.70% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.00% | AACGGATG: 0.37% |
| Indica I | 595 | 98.70% | 0.50% | 0.84% | 0.00% | NA |
| Indica II | 465 | 68.80% | 30.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 4.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 99.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 38.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524596703 | A -> G | LOC_Os05g42020.1 | 3_prime_UTR_variant ; 260.0bp to feature; MODIFIER | silent_mutation | Average:68.763; most accessible tissue: Callus, score: 90.939 | N | N | N | N |
| vg0524596703 | A -> G | LOC_Os05g42010.1 | upstream_gene_variant ; 3444.0bp to feature; MODIFIER | silent_mutation | Average:68.763; most accessible tissue: Callus, score: 90.939 | N | N | N | N |
| vg0524596703 | A -> G | LOC_Os05g42010.2 | upstream_gene_variant ; 3444.0bp to feature; MODIFIER | silent_mutation | Average:68.763; most accessible tissue: Callus, score: 90.939 | N | N | N | N |
| vg0524596703 | A -> AACGGATG | LOC_Os05g42020.1 | 3_prime_UTR_variant ; 261.0bp to feature; MODIFIER | silent_mutation | Average:68.763; most accessible tissue: Callus, score: 90.939 | N | N | N | N |
| vg0524596703 | A -> AACGGATG | LOC_Os05g42010.1 | upstream_gene_variant ; 3445.0bp to feature; MODIFIER | silent_mutation | Average:68.763; most accessible tissue: Callus, score: 90.939 | N | N | N | N |
| vg0524596703 | A -> AACGGATG | LOC_Os05g42010.2 | upstream_gene_variant ; 3445.0bp to feature; MODIFIER | silent_mutation | Average:68.763; most accessible tissue: Callus, score: 90.939 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524596703 | NA | 6.21E-16 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 1.88E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 7.95E-28 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 1.10E-45 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 1.31E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 3.08E-16 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 1.13E-10 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 1.45E-27 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 9.96E-16 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524596703 | NA | 4.22E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/