Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524582362:

Variant ID: vg0524582362 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24582362
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCCGTTTCAAAATATTTGACACCGTTGACTTTTTAGCACATATTTGACCGTTCATCTTATTTAAAAATTTTTGTGAAATATGTAAAACTATTTGTGTA[C/T]
ATGAAAGTATATTTAACAATAAATCAAATGATGTGAAAAGAATAAATAATTACTTTAATTTTTTGAATAAAACGAATGATTAAACACGTACTAAAAAGTC

Reverse complement sequence

GACTTTTTAGTACGTGTTTAATCATTCGTTTTATTCAAAAAATTAAAGTAATTATTTATTCTTTTCACATCATTTGATTTATTGTTAAATATACTTTCAT[G/A]
TACACAAATAGTTTTACATATTTCACAAAAATTTTTAAATAAGATGAACGGTCAAATATGTGCTAAAAAGTCAACGGTGTCAAATATTTTGAAACGGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	5.40%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	24.50%	75.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	2.00%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524582362	C -> T	LOC_Os05g41970.1	upstream_gene_variant ; 4626.0bp to feature; MODIFIER	silent_mutation	Average:40.308; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0524582362	C -> T	LOC_Os05g41990.1	upstream_gene_variant ; 888.0bp to feature; MODIFIER	silent_mutation	Average:40.308; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0524582362	C -> T	LOC_Os05g42000.1	upstream_gene_variant ; 4783.0bp to feature; MODIFIER	silent_mutation	Average:40.308; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0524582362	C -> T	LOC_Os05g42000.2	upstream_gene_variant ; 4783.0bp to feature; MODIFIER	silent_mutation	Average:40.308; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0524582362	C -> T	LOC_Os05g41980.1	downstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:40.308; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0524582362	C -> T	LOC_Os05g41980-LOC_Os05g41990	intergenic_region ; MODIFIER	silent_mutation	Average:40.308; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524582362	NA	6.38E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	1.22E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	2.60E-11	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	3.46E-09	1.43E-19	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	9.61E-06	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	4.16E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	3.94E-06	NA	mr1935	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	2.92E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	2.55E-07	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	8.60E-17	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	4.03E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	3.04E-10	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	1.13E-09	2.23E-16	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	NA	2.09E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524582362	7.85E-06	NA	mr1896_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251