\
| Variant ID: vg0524508210 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 24508210 |
| Reference Allele: GGAT | Alternative Allele: AGAT,G |
| Primary Allele: GGAT | Secondary Allele: AGAT |
Inferred Ancestral Allele: Not determined.
ACGCAGCTAAGGATTGCTTCGTCTACAAGCAGTTTGCAGAGCAATATGCCAAGAATGCACGGAAGACCCCTGACGGAGAACAAAGTACGTCGAAAAAGAA[GGAT/AGAT,G]
GATGATGATGATCCCCCGACAGGTTTTCAGGATCACCGTAAGGAGCTCAACCACATCTTTGGCGGCCCTCTGGCTTACGAGTCTAAAAGAAAGCAAAAGC
GCTTTTGCTTTCTTTTAGACTCGTAAGCCAGAGGGCCGCCAAAGATGTGGTTGAGCTCCTTACGGTGATCCTGAAAACCTGTCGGGGGATCATCATCATC[ATCC/ATCT,C]
TTCTTTTTCGACGTACTTTGTTCTCCGTCAGGGGTCTTCCGTGCATTCTTGGCATATTGCTCTGCAAACTGCTTGTAGACGAAGCAATCCTTAGCTGCGT
| Populations | Population Size | Frequency of GGAT(primary allele) | Frequency of AGAT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.60% | 0.25% | 0.00% | G: 0.02% |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.90% | 20.40% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 4.70% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 50.80% | 48.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 11.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 0.00% | G: 1.04% |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524508210 | GGAT -> G | LOC_Os05g41850.1 | inframe_deletion ; p.Asp588del; MODERATE | inframe_variant | Average:31.294; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0524508210 | GGAT -> AGAT | LOC_Os05g41850.1 | synonymous_variant ; p.Lys583Lys; LOW | synonymous_codon | Average:31.294; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524508210 | NA | 2.53E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 2.11E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 2.23E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 3.95E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 5.17E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 5.41E-09 | mr1527 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 5.62E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 7.34E-06 | mr1553 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 5.85E-08 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524508210 | NA | 2.27E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |