| Variant ID: vg0524506809 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24506809 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )
ACAACGCCAAGCCCGAGAAACAAAGGCACGACGTGTACAGCAGGAAGCCGAGCGACGCTGACTGGAAGAGGAGCGCCAAGCACAAGAGTAAGAACGGCTG[C/T]
GGCGAGAGCAACAAGAACGCGAATGGGCTACAAAGGAGGCCGAGGACCGACGACAATGAGCCTTGGACGCAGGGCGACGAGCCCGAGATCTCATCGGGCA
TGCCCGATGAGATCTCGGGCTCGTCGCCCTGCGTCCAAGGCTCATTGTCGTCGGTCCTCGGCCTCCTTTGTAGCCCATTCGCGTTCTTGTTGCTCTCGCC[G/A]
CAGCCGTTCTTACTCTTGTGCTTGGCGCTCCTCTTCCAGTCAGCGTCGCTCGGCTTCCTGCTGTACACGTCGTGCCTTTGTTTCTCGGGCTTGGCGTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 4.80% | 40.54% | 11.13% | NA |
| All Indica | 2759 | 14.40% | 4.70% | 62.12% | 18.77% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Aus | 269 | 13.40% | 28.60% | 57.62% | 0.37% | NA |
| Indica I | 595 | 4.40% | 3.70% | 72.94% | 18.99% | NA |
| Indica II | 465 | 33.10% | 4.90% | 50.97% | 10.97% | NA |
| Indica III | 913 | 13.90% | 4.60% | 56.85% | 24.64% | NA |
| Indica Intermediate | 786 | 11.30% | 5.60% | 66.67% | 16.41% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 12.50% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 6.70% | 38.89% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524506809 | C -> T | LOC_Os05g41840.1 | upstream_gene_variant ; 1732.0bp to feature; MODIFIER | silent_mutation | Average:39.359; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg0524506809 | C -> T | LOC_Os05g41850.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.359; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg0524506809 | C -> DEL | N | N | silent_mutation | Average:39.359; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524506809 | NA | 3.68E-15 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | NA | 2.78E-25 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | NA | 2.68E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | NA | 7.07E-16 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | NA | 6.46E-16 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | NA | 4.47E-15 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | NA | 6.46E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | 2.45E-15 | 3.94E-77 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | 2.45E-12 | 2.87E-27 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524506809 | 3.57E-16 | 7.56E-98 | mr1896 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/