\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524406503:

Variant ID: vg0524406503 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24406503
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GCATAGTTCAATCAGCTACGAAGTCGGCAAGTACCTGGGATTTGATGGTTGTTCGTGGCACAAAGCAGACATCAAACTGGCTTAGCTCGACTACCCATTT[C/T]
GCAATGCGGTCGACAACGTCTTTGTTTCTCACTACTTCACCGAGAGGGAAGGAGGATACAACTATGACCTTGTGGGCTTGAAAGTAGTGGCGTAGCTTTC

Reverse complement sequence

GAAAGCTACGCCACTACTTTCAAGCCCACAAGGTCATAGTTGTATCCTCCTTCCCTCTCGGTGAAGTAGTGAGAAACAAAGACGTTGTCGACCGCATTGC[G/A]
AAATGGGTAGTCGAGCTAAGCCAGTTTGATGTCTGCTTTGTGCCACGAACAACCATCAAATCCCAGGTACTTGCCGACTTCGTAGCTGATTGAACTATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 40.80% 0.17% 0.53% NA
All Indica  2759 87.70% 11.50% 0.07% 0.76% NA
All Japonica  1512 0.40% 99.40% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.50% 0.80% 0.17% 1.51% NA
Indica II  465 68.20% 30.80% 0.00% 1.08% NA
Indica III  913 88.10% 11.80% 0.00% 0.11% NA
Indica Intermediate  786 91.30% 7.80% 0.13% 0.76% NA
Temperate Japonica  767 0.10% 99.70% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 0.00% 99.60% 0.41% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 54.40% 38.90% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524406503 C -> T LOC_Os05g41720.1 synonymous_variant ; p.Ala1277Ala; LOW synonymous_codon Average:31.156; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0524406503 C -> DEL LOC_Os05g41720.1 N frameshift_variant Average:31.156; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524406503 NA 3.90E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 3.04E-34 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 6.47E-26 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.68E-46 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 3.80E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 9.70E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.12E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.21E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.16E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 3.22E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 3.08E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.77E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.88E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.03E-20 8.15E-84 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 2.85E-22 5.43E-37 mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 4.98E-25 2.44E-110 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 4.94E-24 1.59E-36 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.97E-27 1.60E-57 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 7.26E-25 5.55E-37 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 9.38E-32 4.18E-137 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 5.76E-31 1.12E-54 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 4.95E-28 1.79E-128 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.09E-24 1.17E-41 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.48E-26 8.34E-97 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 3.78E-20 2.38E-32 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.97E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.06E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.41E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.34E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 7.41E-16 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.28E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.04E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 8.05E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.47E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 5.56E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 4.67E-08 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 7.72E-12 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.85E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 8.29E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.54E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 8.90E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.03E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 7.17E-12 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 6.65E-48 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 8.23E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 2.12E-21 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 4.19E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 5.20E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.24E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 3.16E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 3.61E-15 2.13E-93 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.20E-10 3.33E-27 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 1.22E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 5.47E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 2.49E-18 1.08E-95 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.56E-14 1.08E-26 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 NA 6.93E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 5.82E-20 1.17E-134 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 3.57E-16 3.80E-39 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 6.53E-22 3.05E-128 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524406503 1.82E-16 2.03E-35 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251