\
| Variant ID: vg0524388914 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24388914 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )
AGACAAGGAGTGATCGACAACGCCAGGTGAAGCTCAACGGTCATGAGTGAATTAAATTGAAGTCCGAAAAACTGCCGCGCGTAACAGACCCAGAAATTTC[C/T]
GGCGGCCATCTCTCTCCTTTCCTTAGAATTCACACCGTCGGAAGTGCGTCTATTTAAGGGAGTTTTGGGGATCCAATTTGAAGTCCGCCTGTTGTGAAAA
TTTTCACAACAGGCGGACTTCAAATTGGATCCCCAAAACTCCCTTAAATAGACGCACTTCCGACGGTGTGAATTCTAAGGAAAGGAGAGAGATGGCCGCC[G/A]
GAAATTTCTGGGTCTGTTACGCGCGGCAGTTTTTCGGACTTCAATTTAATTCACTCATGACCGTTGAGCTTCACCTGGCGTTGTCGATCACTCCTTGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 26.40% | 73.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524388914 | C -> T | LOC_Os05g41660.1 | upstream_gene_variant ; 4286.0bp to feature; MODIFIER | silent_mutation | Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0524388914 | C -> T | LOC_Os05g41670.1 | upstream_gene_variant ; 1446.0bp to feature; MODIFIER | silent_mutation | Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0524388914 | C -> T | LOC_Os05g41680.1 | upstream_gene_variant ; 196.0bp to feature; MODIFIER | silent_mutation | Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0524388914 | C -> T | LOC_Os05g41690.1 | upstream_gene_variant ; 2751.0bp to feature; MODIFIER | silent_mutation | Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0524388914 | C -> T | LOC_Os05g41670-LOC_Os05g41680 | intergenic_region ; MODIFIER | silent_mutation | Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524388914 | 8.69E-10 | 5.17E-20 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | NA | 8.40E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | 3.07E-10 | NA | mr1109_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | NA | 8.16E-17 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | NA | 3.49E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | NA | 4.02E-10 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | 4.88E-13 | 2.63E-19 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524388914 | NA | 3.84E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |