\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524388914:

Variant ID: vg0524388914 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24388914
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGACAAGGAGTGATCGACAACGCCAGGTGAAGCTCAACGGTCATGAGTGAATTAAATTGAAGTCCGAAAAACTGCCGCGCGTAACAGACCCAGAAATTTC[C/T]
GGCGGCCATCTCTCTCCTTTCCTTAGAATTCACACCGTCGGAAGTGCGTCTATTTAAGGGAGTTTTGGGGATCCAATTTGAAGTCCGCCTGTTGTGAAAA

Reverse complement sequence

TTTTCACAACAGGCGGACTTCAAATTGGATCCCCAAAACTCCCTTAAATAGACGCACTTCCGACGGTGTGAATTCTAAGGAAAGGAGAGAGATGGCCGCC[G/A]
GAAATTTCTGGGTCTGTTACGCGCGGCAGTTTTTCGGACTTCAATTTAATTCACTCATGACCGTTGAGCTTCACCTGGCGTTGTCGATCACTCCTTGTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.20% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 26.40% 73.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524388914 C -> T LOC_Os05g41660.1 upstream_gene_variant ; 4286.0bp to feature; MODIFIER silent_mutation Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0524388914 C -> T LOC_Os05g41670.1 upstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0524388914 C -> T LOC_Os05g41680.1 upstream_gene_variant ; 196.0bp to feature; MODIFIER silent_mutation Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0524388914 C -> T LOC_Os05g41690.1 upstream_gene_variant ; 2751.0bp to feature; MODIFIER silent_mutation Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0524388914 C -> T LOC_Os05g41670-LOC_Os05g41680 intergenic_region ; MODIFIER silent_mutation Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524388914 8.69E-10 5.17E-20 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 NA 8.40E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 3.07E-10 NA mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 NA 8.16E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 NA 3.49E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 NA 4.02E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 4.88E-13 2.63E-19 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914 NA 3.84E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251