Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524388914:

Variant ID: vg0524388914 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24388914
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AGACAAGGAGTGATCGACAACGCCAGGTGAAGCTCAACGGTCATGAGTGAATTAAATTGAAGTCCGAAAAACTGCCGCGCGTAACAGACCCAGAAATTTC[C/T]
GGCGGCCATCTCTCTCCTTTCCTTAGAATTCACACCGTCGGAAGTGCGTCTATTTAAGGGAGTTTTGGGGATCCAATTTGAAGTCCGCCTGTTGTGAAAA

Reverse complement sequence

TTTTCACAACAGGCGGACTTCAAATTGGATCCCCAAAACTCCCTTAAATAGACGCACTTCCGACGGTGTGAATTCTAAGGAAAGGAGAGAGATGGCCGCC[G/A]
GAAATTTCTGGGTCTGTTACGCGCGGCAGTTTTTCGGACTTCAATTTAATTCACTCATGACCGTTGAGCTTCACCTGGCGTTGTCGATCACTCCTTGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	5.20%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	26.40%	73.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524388914	C -> T	LOC_Os05g41660.1	upstream_gene_variant ; 4286.0bp to feature; MODIFIER	silent_mutation	Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0524388914	C -> T	LOC_Os05g41670.1	upstream_gene_variant ; 1446.0bp to feature; MODIFIER	silent_mutation	Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0524388914	C -> T	LOC_Os05g41680.1	upstream_gene_variant ; 196.0bp to feature; MODIFIER	silent_mutation	Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0524388914	C -> T	LOC_Os05g41690.1	upstream_gene_variant ; 2751.0bp to feature; MODIFIER	silent_mutation	Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0524388914	C -> T	LOC_Os05g41670-LOC_Os05g41680	intergenic_region ; MODIFIER	silent_mutation	Average:47.716; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524388914	8.69E-10	5.17E-20	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	NA	8.40E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	3.07E-10	NA	mr1109_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	NA	8.16E-17	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	NA	3.49E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	NA	4.02E-10	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	4.88E-13	2.63E-19	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524388914	NA	3.84E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251