Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524354930:

Variant ID: vg0524354930 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24354930
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGAGGGAGAAGTTGGGAATATGGACAATCGAACATAGGGATGAAAACGGACGGAAACCACCTTTATCATTTTCGTTTTTGTCGACGTTTGATGTCTC[G/A]
ACTACGGTATTTGGACAGTATGGGGATCGTCGGTGCTAGGATATATGCGAGACTAAGGTAAAAGAGATGGAGACAGGGATTTTTATACAGGTTCGGGCCC

Reverse complement sequence

GGGCCCGAACCTGTATAAAAATCCCTGTCTCCATCTCTTTTACCTTAGTCTCGCATATATCCTAGCACCGACGATCCCCATACTGTCCAAATACCGTAGT[C/T]
GAGACATCAAACGTCGACAAAAACGAAAATGATAAAGGTGGTTTCCGTCCGTTTTCATCCCTATGTTCGATTGTCCATATTCCCAACTTCTCCCTCTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 43.50% 0.13% 0.11% NA
All Indica  2759 91.80% 7.90% 0.11% 0.18% NA
All Japonica  1512 0.50% 99.50% 0.07% 0.00% NA
Aus  269 25.70% 74.00% 0.37% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 90.80% 8.40% 0.22% 0.65% NA
Indica III  913 87.40% 12.50% 0.00% 0.11% NA
Indica Intermediate  786 93.90% 5.70% 0.25% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 99.60% 0.41% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524354930 G -> DEL N N silent_mutation Average:66.648; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N
vg0524354930 G -> A LOC_Os05g41590.1 upstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:66.648; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N
vg0524354930 G -> A LOC_Os05g41580.1 downstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:66.648; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N
vg0524354930 G -> A LOC_Os05g41580-LOC_Os05g41590 intergenic_region ; MODIFIER silent_mutation Average:66.648; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0524354930 G A -0.02 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524354930 NA 4.18E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 2.97E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.48E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.28E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 4.20E-06 3.57E-16 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 8.45E-12 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.41E-13 mr1903 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 9.89E-06 9.31E-19 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.35E-14 mr1934 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 3.08E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 2.71E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.28E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.53E-59 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.59E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.15E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.29E-38 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 6.12E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 2.83E-10 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 1.08E-10 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 4.70E-10 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524354930 NA 2.95E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251