\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524331456:

Variant ID: vg0524331456 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24331456
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAATCATCGTCAAGAATATTTGGACAAACAAAGAACCTTCGACCCAATGTTGTAGGATTTATGGAACGAAGAAGCTGACAACGATCACCACACCTGCA[T/A]
CTTAGACAGGCTTCCCATGGAGGGAGTGCCGTAGTTAGCACCCGCCAGTCGCTCTGTTGTTCACGACATTGTCGTTCATAAGCCGCTTTTCTCTGTAAGT

Reverse complement sequence

ACTTACAGAGAAAAGCGGCTTATGAACGACAATGTCGTGAACAACAGAGCGACTGGCGGGTGCTAACTACGGCACTCCCTCCATGGGAAGCCTGTCTAAG[A/T]
TGCAGGTGTGGTGATCGTTGTCAGCTTCTTCGTTCCATAAATCCTACAACATTGGGTCGAAGGTTCTTTGTTTGTCCAAATATTCTTGACGATGATTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 0.10% 42.76% 17.96% NA
All Indica  2759 8.20% 0.30% 64.12% 27.47% NA
All Japonica  1512 99.50% 0.00% 0.13% 0.33% NA
Aus  269 0.70% 0.00% 76.21% 23.05% NA
Indica I  595 2.20% 0.30% 58.99% 38.49% NA
Indica II  465 10.30% 0.00% 60.86% 28.82% NA
Indica III  913 12.80% 0.30% 69.44% 17.42% NA
Indica Intermediate  786 6.00% 0.30% 63.74% 30.03% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 98.80% 0.00% 0.40% 0.79% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 0.00% 11.46% 9.38% NA
Intermediate  90 45.60% 0.00% 37.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524331456 T -> DEL N N silent_mutation Average:40.316; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0524331456 T -> A LOC_Os05g41550.2 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:40.316; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0524331456 T -> A LOC_Os05g41550.5 upstream_gene_variant ; 1516.0bp to feature; MODIFIER silent_mutation Average:40.316; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0524331456 T -> A LOC_Os05g41550.3 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:40.316; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0524331456 T -> A LOC_Os05g41560.1 downstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:40.316; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0524331456 T -> A LOC_Os05g41550-LOC_Os05g41560 intergenic_region ; MODIFIER silent_mutation Average:40.316; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524331456 NA 1.45E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 3.42E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 4.36E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 2.99E-63 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 6.57E-11 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 2.26E-81 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 1.14E-10 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 9.59E-32 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 7.06E-11 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 3.36E-06 2.37E-97 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 1.61E-14 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 1.01E-85 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 4.91E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 2.62E-62 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 4.27E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 3.61E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 2.72E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 1.54E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 7.33E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 2.79E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 1.70E-07 NA mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 8.79E-08 4.68E-83 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 5.01E-06 5.55E-15 mr1889_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 1.71E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 9.10E-08 1.74E-81 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 4.34E-06 1.00E-13 mr1896_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 3.52E-07 1.67E-111 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 2.34E-07 8.63E-16 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 1.44E-07 8.09E-99 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524331456 NA 2.36E-12 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251