Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0524262516:

Variant ID: vg0524262516 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24262516
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.28, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGGTGCTACTAGATGTTGCACCGCCGCTCCGCCTCTGACCATGGCAACTTGCCATAGTCGTCCATCTCTACCGAGGGCTCACTAGCACGTTTGCAATT[G/A]
GTTCCATCCGTCGTCTCCATTGAAGAATATCAATTAGATCATACCTCACCCACTTCTTGTAGGAGAAGGTCGTAGTAGCTCATTGGGCAACATATGAGAT

Reverse complement sequence

ATCTCATATGTTGCCCAATGAGCTACTACGACCTTCTCCTACAAGAAGTGGGTGAGGTATGATCTAATTGATATTCTTCAATGGAGACGACGGATGGAAC[C/T]
AATTGCAAACGTGCTAGTGAGCCCTCGGTAGAGATGGACGACTATGGCAAGTTGCCATGGTCAGAGGCGGAGCGGCGGTGCAACATCTAGTAGCACCGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	48.10%	0.17%	0.47%	NA
All Indica	2759	29.10%	69.90%	0.25%	0.76%	NA
All Japonica	1512	99.20%	0.70%	0.07%	0.00%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	21.50%	77.10%	0.17%	1.18%	NA
Indica II	465	17.80%	81.50%	0.22%	0.43%	NA
Indica III	913	44.20%	55.00%	0.11%	0.66%	NA
Indica Intermediate	786	23.80%	74.90%	0.51%	0.76%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	52.20%	46.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524262516	G -> DEL	N	N	silent_mutation	Average:48.601; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0524262516	G -> A	LOC_Os05g41430.1	upstream_gene_variant ; 195.0bp to feature; MODIFIER	silent_mutation	Average:48.601; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0524262516	G -> A	LOC_Os05g41430-LOC_Os05g41440	intergenic_region ; MODIFIER	silent_mutation	Average:48.601; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524262516	NA	4.14E-22	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	2.75E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	8.39E-06	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	1.34E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	1.55E-18	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	2.19E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	1.24E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	1.27E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	8.60E-06	mr1293_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	9.63E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	8.22E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	6.46E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	2.82E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	8.06E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	5.03E-20	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	1.00E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	4.75E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	8.00E-06	mr1700_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	6.64E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	2.03E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516	NA	1.87E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251