\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524262516:

Variant ID: vg0524262516 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24262516
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.28, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGGTGCTACTAGATGTTGCACCGCCGCTCCGCCTCTGACCATGGCAACTTGCCATAGTCGTCCATCTCTACCGAGGGCTCACTAGCACGTTTGCAATT[G/A]
GTTCCATCCGTCGTCTCCATTGAAGAATATCAATTAGATCATACCTCACCCACTTCTTGTAGGAGAAGGTCGTAGTAGCTCATTGGGCAACATATGAGAT

Reverse complement sequence

ATCTCATATGTTGCCCAATGAGCTACTACGACCTTCTCCTACAAGAAGTGGGTGAGGTATGATCTAATTGATATTCTTCAATGGAGACGACGGATGGAAC[C/T]
AATTGCAAACGTGCTAGTGAGCCCTCGGTAGAGATGGACGACTATGGCAAGTTGCCATGGTCAGAGGCGGAGCGGCGGTGCAACATCTAGTAGCACCGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.10% 0.17% 0.47% NA
All Indica  2759 29.10% 69.90% 0.25% 0.76% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 21.50% 77.10% 0.17% 1.18% NA
Indica II  465 17.80% 81.50% 0.22% 0.43% NA
Indica III  913 44.20% 55.00% 0.11% 0.66% NA
Indica Intermediate  786 23.80% 74.90% 0.51% 0.76% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524262516 G -> DEL N N silent_mutation Average:48.601; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0524262516 G -> A LOC_Os05g41430.1 upstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:48.601; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0524262516 G -> A LOC_Os05g41430-LOC_Os05g41440 intergenic_region ; MODIFIER silent_mutation Average:48.601; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524262516 NA 4.14E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 2.75E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 8.39E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 1.34E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 1.55E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 2.19E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 1.24E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 1.27E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 8.60E-06 mr1293_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 9.63E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 8.22E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 6.46E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 2.82E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 8.06E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 5.03E-20 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 1.00E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 4.75E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 8.00E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 6.64E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 2.03E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524262516 NA 1.87E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251