\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524244054:

Variant ID: vg0524244054 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24244054
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGATCCAAAGTTTGGATCCAAACTTCAAACTTCAGTTCTTTTCCATCACATCGACTTGTTATACACACAACTTTTCAGTCACATCATCTTCAATTTCAA[C/T]
CAAAATCCAAACTTTGCGCTGAACTAAACACAGCCTCAGTTTCAAATAGAGAACAAACTAAAAGCTTATTTCAAATAAGTGGTTTCAGGCAAACAAGTTT

Reverse complement sequence

AAACTTGTTTGCCTGAAACCACTTATTTGAAATAAGCTTTTAGTTTGTTCTCTATTTGAAACTGAGGCTGTGTTTAGTTCAGCGCAAAGTTTGGATTTTG[G/A]
TTGAAATTGAAGATGATGTGACTGAAAAGTTGTGTGTATAACAAGTCGATGTGATGGAAAAGAACTGAAGTTTGAAGTTTGGATCCAAACTTTGGATCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.40% 2.60% 1.06% 0.00% NA
All Indica  2759 93.80% 4.40% 1.78% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.50% 11.40% 7.06% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 3.70% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524244054 C -> T LOC_Os05g41410.1 upstream_gene_variant ; 2721.0bp to feature; MODIFIER silent_mutation Average:54.477; most accessible tissue: Callus, score: 86.001 N N N N
vg0524244054 C -> T LOC_Os05g41390.1 downstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:54.477; most accessible tissue: Callus, score: 86.001 N N N N
vg0524244054 C -> T LOC_Os05g41400.1 downstream_gene_variant ; 100.0bp to feature; MODIFIER silent_mutation Average:54.477; most accessible tissue: Callus, score: 86.001 N N N N
vg0524244054 C -> T LOC_Os05g41390-LOC_Os05g41400 intergenic_region ; MODIFIER silent_mutation Average:54.477; most accessible tissue: Callus, score: 86.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524244054 NA 2.29E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524244054 1.31E-06 1.73E-06 mr1305_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524244054 NA 4.38E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524244054 3.33E-06 2.32E-06 mr1409_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524244054 1.60E-06 1.55E-07 mr1559_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524244054 7.54E-06 1.41E-06 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251