\
| Variant ID: vg0524244054 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24244054 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGATCCAAAGTTTGGATCCAAACTTCAAACTTCAGTTCTTTTCCATCACATCGACTTGTTATACACACAACTTTTCAGTCACATCATCTTCAATTTCAA[C/T]
CAAAATCCAAACTTTGCGCTGAACTAAACACAGCCTCAGTTTCAAATAGAGAACAAACTAAAAGCTTATTTCAAATAAGTGGTTTCAGGCAAACAAGTTT
AAACTTGTTTGCCTGAAACCACTTATTTGAAATAAGCTTTTAGTTTGTTCTCTATTTGAAACTGAGGCTGTGTTTAGTTCAGCGCAAAGTTTGGATTTTG[G/A]
TTGAAATTGAAGATGATGTGACTGAAAAGTTGTGTGTATAACAAGTCGATGTGATGGAAAAGAACTGAAGTTTGAAGTTTGGATCCAAACTTTGGATCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 2.60% | 1.06% | 0.00% | NA |
| All Indica | 2759 | 93.80% | 4.40% | 1.78% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.50% | 11.40% | 7.06% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 3.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524244054 | C -> T | LOC_Os05g41410.1 | upstream_gene_variant ; 2721.0bp to feature; MODIFIER | silent_mutation | Average:54.477; most accessible tissue: Callus, score: 86.001 | N | N | N | N |
| vg0524244054 | C -> T | LOC_Os05g41390.1 | downstream_gene_variant ; 400.0bp to feature; MODIFIER | silent_mutation | Average:54.477; most accessible tissue: Callus, score: 86.001 | N | N | N | N |
| vg0524244054 | C -> T | LOC_Os05g41400.1 | downstream_gene_variant ; 100.0bp to feature; MODIFIER | silent_mutation | Average:54.477; most accessible tissue: Callus, score: 86.001 | N | N | N | N |
| vg0524244054 | C -> T | LOC_Os05g41390-LOC_Os05g41400 | intergenic_region ; MODIFIER | silent_mutation | Average:54.477; most accessible tissue: Callus, score: 86.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524244054 | NA | 2.29E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524244054 | 1.31E-06 | 1.73E-06 | mr1305_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524244054 | NA | 4.38E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524244054 | 3.33E-06 | 2.32E-06 | mr1409_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524244054 | 1.60E-06 | 1.55E-07 | mr1559_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524244054 | 7.54E-06 | 1.41E-06 | mr1585_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |