\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524168704:

Variant ID: vg0524168704 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24168704
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCAAATTACATAACATTGGTGGAGAAGTGCTTTATAGTCCCGGTTCGTAAAAACCGGGACTAACAATCCGGGACTAAAGATCGCTATCTTTAGTC[C/A]
CGGGTGAAAAAACCAGGACTAAAGATCGATCTTTAGTCCCGATTGATGATACCAACCGGGATTAAAGATAGAGATCTTACCAACCGGGACTAAAGAGAGG

Reverse complement sequence

CCTCTCTTTAGTCCCGGTTGGTAAGATCTCTATCTTTAATCCCGGTTGGTATCATCAATCGGGACTAAAGATCGATCTTTAGTCCTGGTTTTTTCACCCG[G/T]
GACTAAAGATAGCGATCTTTAGTCCCGGATTGTTAGTCCCGGTTTTTACGAACCGGGACTATAAAGCACTTCTCCACCAATGTTATGTAATTTGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 0.50% 4.82% 0.00% NA
All Indica  2759 99.10% 0.10% 0.76% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 31.20% 3.70% 65.06% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.30% 0.10% 0.55% 0.00% NA
Indica Intermediate  786 97.70% 0.30% 2.04% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 6.20% 29.17% 0.00% NA
Intermediate  90 93.30% 2.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524168704 C -> A LOC_Os05g41250.1 downstream_gene_variant ; 2630.0bp to feature; MODIFIER silent_mutation Average:22.668; most accessible tissue: Callus, score: 45.348 N N N N
vg0524168704 C -> A LOC_Os05g41240-LOC_Os05g41250 intergenic_region ; MODIFIER silent_mutation Average:22.668; most accessible tissue: Callus, score: 45.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524168704 NA 4.85E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 5.79E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 9.29E-11 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 5.63E-17 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 5.59E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 7.22E-22 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 9.90E-10 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 9.52E-12 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 2.38E-08 NA mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 8.65E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 7.55E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 1.67E-12 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 8.29E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 1.93E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524168704 NA 6.17E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251