| Variant ID: vg0524068712 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24068712 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 259. )
GAACAGACACAACAAAATAGGGAGGTTGCATATTTGTAGTATATAGGTGTTCTACTGAAAAAGGATAATAATTTAGCAATCTGACTCATAAATCAACACA[C/T]
AGAGATATTCATTTTATTGATCATGGAAGATTTGTACATTTTTCAGTTACACTCTTGAGCCGTGACTTGAGTCTTGAAGCAGAATGGAATTTAAACAGTA
TACTGTTTAAATTCCATTCTGCTTCAAGACTCAAGTCACGGCTCAAGAGTGTAACTGAAAAATGTACAAATCTTCCATGATCAATAAAATGAATATCTCT[G/A]
TGTGTTGATTTATGAGTCAGATTGCTAAATTATTATCCTTTTTCAGTAGAACACCTATATACTACAAATATGCAACCTCCCTATTTTGTTGTGTCTGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 46.10% | 53.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524068712 | C -> T | LOC_Os05g41070.1 | downstream_gene_variant ; 2669.0bp to feature; MODIFIER | silent_mutation | Average:59.795; most accessible tissue: Callus, score: 87.312 | N | N | N | N |
| vg0524068712 | C -> T | LOC_Os05g41090.1 | downstream_gene_variant ; 2463.0bp to feature; MODIFIER | silent_mutation | Average:59.795; most accessible tissue: Callus, score: 87.312 | N | N | N | N |
| vg0524068712 | C -> T | LOC_Os05g41080.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.795; most accessible tissue: Callus, score: 87.312 | N | N | N | N |
| vg0524068712 | C -> T | LOC_Os05g41080.2 | intron_variant ; MODIFIER | silent_mutation | Average:59.795; most accessible tissue: Callus, score: 87.312 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524068712 | NA | 7.66E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | 1.23E-06 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | NA | 2.59E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | NA | 1.36E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | NA | 1.51E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | NA | 4.68E-10 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | NA | 5.41E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | NA | 2.49E-14 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524068712 | 2.87E-09 | NA | mr1855_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |