Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524068712:

Variant ID: vg0524068712 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24068712
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GAACAGACACAACAAAATAGGGAGGTTGCATATTTGTAGTATATAGGTGTTCTACTGAAAAAGGATAATAATTTAGCAATCTGACTCATAAATCAACACA[C/T]
AGAGATATTCATTTTATTGATCATGGAAGATTTGTACATTTTTCAGTTACACTCTTGAGCCGTGACTTGAGTCTTGAAGCAGAATGGAATTTAAACAGTA

Reverse complement sequence

TACTGTTTAAATTCCATTCTGCTTCAAGACTCAAGTCACGGCTCAAGAGTGTAACTGAAAAATGTACAAATCTTCCATGATCAATAAAATGAATATCTCT[G/A]
TGTGTTGATTTATGAGTCAGATTGCTAAATTATTATCCTTTTTCAGTAGAACACCTATATACTACAAATATGCAACCTCCCTATTTTGTTGTGTCTGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.50% 0.04% 0.00% NA
All Indica  2759 98.80% 1.10% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 46.10% 53.50% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.70% 1.20% 0.11% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524068712 C -> T LOC_Os05g41070.1 downstream_gene_variant ; 2669.0bp to feature; MODIFIER silent_mutation Average:59.795; most accessible tissue: Callus, score: 87.312 N N N N
vg0524068712 C -> T LOC_Os05g41090.1 downstream_gene_variant ; 2463.0bp to feature; MODIFIER silent_mutation Average:59.795; most accessible tissue: Callus, score: 87.312 N N N N
vg0524068712 C -> T LOC_Os05g41080.1 intron_variant ; MODIFIER silent_mutation Average:59.795; most accessible tissue: Callus, score: 87.312 N N N N
vg0524068712 C -> T LOC_Os05g41080.2 intron_variant ; MODIFIER silent_mutation Average:59.795; most accessible tissue: Callus, score: 87.312 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524068712 NA 7.66E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 1.23E-06 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 NA 2.59E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 NA 1.36E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 NA 1.51E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 NA 4.68E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 NA 5.41E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 NA 2.49E-14 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524068712 2.87E-09 NA mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251