\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523997343:

Variant ID: vg0523997343 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23997343
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.19, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTATATGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAAATTTAAAATAGTTAATACTCAATTAATCATGAGTTAATGGCTTACCTCGTTTT[A/G]
CGTATCTTTCTAATCTCCTCAATCCCCTTCTCCTCAAACACACCCTAAGTTATGCTTGTGTACCATCTACTTAATTATCTAAGAGGTCATGATATCTTGC

Reverse complement sequence

GCAAGATATCATGACCTCTTAGATAATTAAGTAGATGGTACACAAGCATAACTTAGGGTGTGTTTGAGGAGAAGGGGATTGAGGAGATTAGAAAGATACG[T/C]
AAAACGAGGTAAGCCATTAACTCATGATTAATTGAGTATTAACTATTTTAAATTTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCATATAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 37.80% 0.21% 0.00% NA
All Indica  2759 92.60% 7.00% 0.36% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 88.20% 11.00% 0.86% 0.00% NA
Indica III  913 88.40% 11.40% 0.22% 0.00% NA
Indica Intermediate  786 94.90% 4.70% 0.38% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523997343 A -> G LOC_Os05g40910.1 3_prime_UTR_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:47.06; most accessible tissue: Callus, score: 79.655 N N N N
vg0523997343 A -> G LOC_Os05g40900.1 upstream_gene_variant ; 2906.0bp to feature; MODIFIER silent_mutation Average:47.06; most accessible tissue: Callus, score: 79.655 N N N N
vg0523997343 A -> G LOC_Os05g40900.2 upstream_gene_variant ; 2906.0bp to feature; MODIFIER silent_mutation Average:47.06; most accessible tissue: Callus, score: 79.655 N N N N
vg0523997343 A -> G LOC_Os05g40920.1 downstream_gene_variant ; 2924.0bp to feature; MODIFIER silent_mutation Average:47.06; most accessible tissue: Callus, score: 79.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523997343 NA 1.23E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.23E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.22E-26 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.86E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 3.73E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 9.14E-27 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 5.44E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.22E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.80E-54 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 5.51E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.22E-72 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.63E-27 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.98E-88 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 5.29E-11 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.69E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 2.81E-85 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 9.56E-59 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 8.11E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 3.87E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.80E-23 mr1168_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 3.25E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.27E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.58E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.77E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.43E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 3.63E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.82E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 3.71E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 3.28E-70 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.41E-09 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 4.51E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 7.15E-68 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 6.40E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.56E-95 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 1.14E-94 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523997343 NA 2.33E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251