\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523892684:

Variant ID: vg0523892684 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23892684
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTGCTATTGTTGAATTCATCCTTCACGGCACGCAAGCGTACTTTAGGGATCGATACAAGAAAATTGGTCCGTCCATGGCCGATAACAACATAGTGTTT[G/A]
GCAACGTAGTGATAAAGTACATGGAAGATAAAATCAAAAAGGCACGGAGACATAGAGTTGTTGCTCAAGGCACACAAGTGCATCGGTATGAAATAATGTG

Reverse complement sequence

CACATTATTTCATACCGATGCACTTGTGTGCCTTGAGCAACAACTCTATGTCTCCGTGCCTTTTTGATTTTATCTTCCATGTACTTTATCACTACGTTGC[C/T]
AAACACTATGTTGTTATCGGCCATGGACGGACCAATTTTCTTGTATCGATCCCTAAAGTACGCTTGCGTGCCGTGAAGGATGAATTCAACAATAGCAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 1.50% 2.39% 59.20% NA
All Indica  2759 7.90% 0.20% 2.65% 89.20% NA
All Japonica  1512 94.20% 4.00% 1.12% 0.60% NA
Aus  269 0.40% 0.00% 4.09% 95.54% NA
Indica I  595 1.70% 0.00% 0.67% 97.65% NA
Indica II  465 11.40% 0.90% 3.87% 83.87% NA
Indica III  913 11.40% 0.00% 2.63% 85.98% NA
Indica Intermediate  786 6.60% 0.30% 3.44% 89.69% NA
Temperate Japonica  767 97.90% 0.30% 1.83% 0.00% NA
Tropical Japonica  504 87.10% 10.50% 0.60% 1.79% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 0.00% 6.25% 29.17% NA
Intermediate  90 38.90% 6.70% 6.67% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523892684 G -> DEL N N silent_mutation Average:11.229; most accessible tissue: Callus, score: 26.866 N N N N
vg0523892684 G -> A LOC_Os05g40750.1 upstream_gene_variant ; 2972.0bp to feature; MODIFIER silent_mutation Average:11.229; most accessible tissue: Callus, score: 26.866 N N N N
vg0523892684 G -> A LOC_Os05g40760.1 intron_variant ; MODIFIER silent_mutation Average:11.229; most accessible tissue: Callus, score: 26.866 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523892684 2.22E-06 7.87E-08 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 1.20E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 8.38E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 3.30E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 5.73E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 2.63E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 1.88E-08 4.20E-12 mr1125_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 3.53E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 NA 1.83E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 2.21E-06 2.21E-06 mr1448_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523892684 6.64E-06 NA mr1750_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251