\
| Variant ID: vg0523892684 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23892684 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTTGCTATTGTTGAATTCATCCTTCACGGCACGCAAGCGTACTTTAGGGATCGATACAAGAAAATTGGTCCGTCCATGGCCGATAACAACATAGTGTTT[G/A]
GCAACGTAGTGATAAAGTACATGGAAGATAAAATCAAAAAGGCACGGAGACATAGAGTTGTTGCTCAAGGCACACAAGTGCATCGGTATGAAATAATGTG
CACATTATTTCATACCGATGCACTTGTGTGCCTTGAGCAACAACTCTATGTCTCCGTGCCTTTTTGATTTTATCTTCCATGTACTTTATCACTACGTTGC[C/T]
AAACACTATGTTGTTATCGGCCATGGACGGACCAATTTTCTTGTATCGATCCCTAAAGTACGCTTGCGTGCCGTGAAGGATGAATTCAACAATAGCAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.90% | 1.50% | 2.39% | 59.20% | NA |
| All Indica | 2759 | 7.90% | 0.20% | 2.65% | 89.20% | NA |
| All Japonica | 1512 | 94.20% | 4.00% | 1.12% | 0.60% | NA |
| Aus | 269 | 0.40% | 0.00% | 4.09% | 95.54% | NA |
| Indica I | 595 | 1.70% | 0.00% | 0.67% | 97.65% | NA |
| Indica II | 465 | 11.40% | 0.90% | 3.87% | 83.87% | NA |
| Indica III | 913 | 11.40% | 0.00% | 2.63% | 85.98% | NA |
| Indica Intermediate | 786 | 6.60% | 0.30% | 3.44% | 89.69% | NA |
| Temperate Japonica | 767 | 97.90% | 0.30% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 10.50% | 0.60% | 1.79% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 0.00% | 6.25% | 29.17% | NA |
| Intermediate | 90 | 38.90% | 6.70% | 6.67% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523892684 | G -> DEL | N | N | silent_mutation | Average:11.229; most accessible tissue: Callus, score: 26.866 | N | N | N | N |
| vg0523892684 | G -> A | LOC_Os05g40750.1 | upstream_gene_variant ; 2972.0bp to feature; MODIFIER | silent_mutation | Average:11.229; most accessible tissue: Callus, score: 26.866 | N | N | N | N |
| vg0523892684 | G -> A | LOC_Os05g40760.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.229; most accessible tissue: Callus, score: 26.866 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523892684 | 2.22E-06 | 7.87E-08 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 1.20E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 8.38E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 3.30E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 5.73E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 2.63E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | 1.88E-08 | 4.20E-12 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 3.53E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | NA | 1.83E-06 | mr1200_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | 2.21E-06 | 2.21E-06 | mr1448_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523892684 | 6.64E-06 | NA | mr1750_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |