\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523880474:

Variant ID: vg0523880474 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23880474
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTCCAAAAAAACTTTTCGTAAAAACATCATATCGAATCTTTGGACATATATATGGAGCATTAAATATAGATAAAAAGAAAAAATAATTGCACAGTTT[G/A]
CATGCAAATCGCGAGACGAATCTTTGAACCTAATTAGACCATGATTAGGCATAAGTGCTACAGTAATTCACATGTACTAATGACGGATTAATTAGGCTCA

Reverse complement sequence

TGAGCCTAATTAATCCGTCATTAGTACATGTGAATTACTGTAGCACTTATGCCTAATCATGGTCTAATTAGGTTCAAAGATTCGTCTCGCGATTTGCATG[C/T]
AAACTGTGCAATTATTTTTTCTTTTTATCTATATTTAATGCTCCATATATATGTCCAAAGATTCGATATGATGTTTTTACGAAAAGTTTTTTTGGAACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 11.90% 0.47% 0.00% NA
All Indica  2759 93.30% 6.70% 0.00% 0.00% NA
All Japonica  1512 73.90% 24.70% 1.39% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 90.00% 10.00% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 8.30% 0.00% 0.00% NA
Temperate Japonica  767 94.90% 4.20% 0.91% 0.00% NA
Tropical Japonica  504 42.70% 55.20% 2.18% 0.00% NA
Japonica Intermediate  241 72.20% 26.60% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523880474 G -> A LOC_Os05g40720.1 upstream_gene_variant ; 2196.0bp to feature; MODIFIER silent_mutation Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0523880474 G -> A LOC_Os05g40740.1 downstream_gene_variant ; 2932.0bp to feature; MODIFIER silent_mutation Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0523880474 G -> A LOC_Os05g40740.3 downstream_gene_variant ; 2936.0bp to feature; MODIFIER silent_mutation Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0523880474 G -> A LOC_Os05g40740.4 downstream_gene_variant ; 2936.0bp to feature; MODIFIER silent_mutation Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0523880474 G -> A LOC_Os05g40740.2 downstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0523880474 G -> A LOC_Os05g40730.1 intron_variant ; MODIFIER silent_mutation Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523880474 3.51E-08 NA mr1125 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 1.64E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 6.80E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 8.95E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 5.31E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 5.85E-08 NA mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 1.58E-06 NA mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 1.25E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 3.12E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 1.13E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 9.13E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 6.86E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523880474 NA 2.04E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251