\
| Variant ID: vg0523880474 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23880474 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 259. )
TAGTTCCAAAAAAACTTTTCGTAAAAACATCATATCGAATCTTTGGACATATATATGGAGCATTAAATATAGATAAAAAGAAAAAATAATTGCACAGTTT[G/A]
CATGCAAATCGCGAGACGAATCTTTGAACCTAATTAGACCATGATTAGGCATAAGTGCTACAGTAATTCACATGTACTAATGACGGATTAATTAGGCTCA
TGAGCCTAATTAATCCGTCATTAGTACATGTGAATTACTGTAGCACTTATGCCTAATCATGGTCTAATTAGGTTCAAAGATTCGTCTCGCGATTTGCATG[C/T]
AAACTGTGCAATTATTTTTTCTTTTTATCTATATTTAATGCTCCATATATATGTCCAAAGATTCGATATGATGTTTTTACGAAAAGTTTTTTTGGAACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 11.90% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.90% | 24.70% | 1.39% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 4.20% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 42.70% | 55.20% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 26.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523880474 | G -> A | LOC_Os05g40720.1 | upstream_gene_variant ; 2196.0bp to feature; MODIFIER | silent_mutation | Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0523880474 | G -> A | LOC_Os05g40740.1 | downstream_gene_variant ; 2932.0bp to feature; MODIFIER | silent_mutation | Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0523880474 | G -> A | LOC_Os05g40740.3 | downstream_gene_variant ; 2936.0bp to feature; MODIFIER | silent_mutation | Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0523880474 | G -> A | LOC_Os05g40740.4 | downstream_gene_variant ; 2936.0bp to feature; MODIFIER | silent_mutation | Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0523880474 | G -> A | LOC_Os05g40740.2 | downstream_gene_variant ; 2942.0bp to feature; MODIFIER | silent_mutation | Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0523880474 | G -> A | LOC_Os05g40730.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.508; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523880474 | 3.51E-08 | NA | mr1125 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 1.64E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 6.80E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 8.95E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 5.31E-14 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | 5.85E-08 | NA | mr1125_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | 1.58E-06 | NA | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 1.25E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 3.12E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 1.13E-11 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 9.13E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 6.86E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523880474 | NA | 2.04E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |