Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523862750:

Variant ID: vg0523862750 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23862750
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGCCCTCTCTCTCCCTCACTCTCCCCGCGCCCCTTGGGCCGCCTCTCTGGGCCGGCCGGCCCATTAGTTTGGCCGAGCCGCGCCTCTCCTCTCGGGCC[A/G]
CGCCCAAGCCGCCCGAGGGAGTCTAAATCACATCCCTCCAATTTCTTTCCAAAAAGGGTTTAATAAATTATTAAATCCTTTTTCCTTTGATTAGTAAATC

Reverse complement sequence

GATTTACTAATCAAAGGAAAAAGGATTTAATAATTTATTAAACCCTTTTTGGAAAGAAATTGGAGGGATGTGATTTAGACTCCCTCGGGCGGCTTGGGCG[T/C]
GGCCCGAGAGGAGAGGCGCGGCTCGGCCAAACTAATGGGCCGGCCGGCCCAGAGAGGCGGCCCAAGGGGCGCGGGGAGAGTGAGGGAGAGAGAGGGCCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	34.40%	0.13%	2.09%	NA
All Indica	2759	90.90%	5.40%	0.14%	3.52%	NA
All Japonica	1512	12.20%	87.80%	0.00%	0.00%	NA
Aus	269	69.90%	29.70%	0.00%	0.37%	NA
Indica I	595	95.80%	0.70%	0.00%	3.53%	NA
Indica II	465	95.30%	4.30%	0.43%	0.00%	NA
Indica III	913	83.20%	9.70%	0.00%	7.01%	NA
Indica Intermediate	786	93.50%	4.70%	0.25%	1.53%	NA
Temperate Japonica	767	5.30%	94.70%	0.00%	0.00%	NA
Tropical Japonica	504	20.60%	79.40%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	83.40%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	64.40%	32.20%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523862750	A -> DEL	N	N	silent_mutation	Average:36.959; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0523862750	A -> G	LOC_Os05g40700.1	upstream_gene_variant ; 3003.0bp to feature; MODIFIER	silent_mutation	Average:36.959; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0523862750	A -> G	LOC_Os05g40680-LOC_Os05g40700	intergenic_region ; MODIFIER	silent_mutation	Average:36.959; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523862750	NA	2.97E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	3.77E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	5.39E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	8.75E-07	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	4.94E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	9.77E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	3.25E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	8.46E-11	mr1666	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	1.37E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	7.75E-10	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	1.41E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	4.02E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523862750	NA	2.57E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251