\
| Variant ID: vg0523792337 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23792337 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )
TCTTTTTGTGGTCCAAGTTATTTTGTTTTTGTTACCCATGTAATGGGTGGAGCTTCAATGCTTATGTCTGAACTTGGTTGGCTGTGTACATCCCGTTGGA[T/C]
GTAGAGGCCGGGTTTTTAACCCATTATCTAAAAAAAAATTCATCAGATCAGATATCAAATTGCATTCATGTAAATCTGATTTGGAAGCGTTTTCTGCTAC
GTAGCAGAAAACGCTTCCAAATCAGATTTACATGAATGCAATTTGATATCTGATCTGATGAATTTTTTTTTAGATAATGGGTTAAAAACCCGGCCTCTAC[A/G]
TCCAACGGGATGTACACAGCCAACCAAGTTCAGACATAAGCATTGAAGCTCCACCCATTACATGGGTAACAAAAACAAAATAACTTGGACCACAAAAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 1.80% | 0.83% | 4.32% | NA |
| All Indica | 2759 | 98.90% | 0.20% | 0.14% | 0.72% | NA |
| All Japonica | 1512 | 94.70% | 4.80% | 0.46% | 0.00% | NA |
| Aus | 269 | 34.60% | 0.00% | 8.55% | 56.88% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.90% | 0.22% | 0.43% | NA |
| Indica III | 913 | 99.10% | 0.00% | 0.11% | 0.77% | NA |
| Indica Intermediate | 786 | 98.10% | 0.30% | 0.25% | 1.40% | NA |
| Temperate Japonica | 767 | 98.20% | 0.90% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 0.00% | 5.21% | 26.04% | NA |
| Intermediate | 90 | 87.80% | 5.60% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523792337 | T -> DEL | N | N | silent_mutation | Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0523792337 | T -> C | LOC_Os05g40500.1 | upstream_gene_variant ; 4412.0bp to feature; MODIFIER | silent_mutation | Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0523792337 | T -> C | LOC_Os05g40530.1 | upstream_gene_variant ; 4259.0bp to feature; MODIFIER | silent_mutation | Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0523792337 | T -> C | LOC_Os05g40510.1 | downstream_gene_variant ; 2333.0bp to feature; MODIFIER | silent_mutation | Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0523792337 | T -> C | LOC_Os05g40520.1 | downstream_gene_variant ; 642.0bp to feature; MODIFIER | silent_mutation | Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0523792337 | T -> C | LOC_Os05g40510-LOC_Os05g40520 | intergenic_region ; MODIFIER | silent_mutation | Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523792337 | NA | 1.18E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 6.92E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 4.34E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | 5.16E-06 | 1.78E-07 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | 9.54E-07 | 4.35E-08 | mr1090_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 1.47E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 5.89E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 2.40E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | 3.40E-07 | 1.98E-10 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 9.03E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | 5.99E-06 | 2.38E-07 | mr1200_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 3.27E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | NA | 6.38E-06 | mr1253_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523792337 | 4.33E-07 | 4.33E-07 | mr1448_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |