\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523792337:

Variant ID: vg0523792337 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23792337
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTTGTGGTCCAAGTTATTTTGTTTTTGTTACCCATGTAATGGGTGGAGCTTCAATGCTTATGTCTGAACTTGGTTGGCTGTGTACATCCCGTTGGA[T/C]
GTAGAGGCCGGGTTTTTAACCCATTATCTAAAAAAAAATTCATCAGATCAGATATCAAATTGCATTCATGTAAATCTGATTTGGAAGCGTTTTCTGCTAC

Reverse complement sequence

GTAGCAGAAAACGCTTCCAAATCAGATTTACATGAATGCAATTTGATATCTGATCTGATGAATTTTTTTTTAGATAATGGGTTAAAAACCCGGCCTCTAC[A/G]
TCCAACGGGATGTACACAGCCAACCAAGTTCAGACATAAGCATTGAAGCTCCACCCATTACATGGGTAACAAAAACAAAATAACTTGGACCACAAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 1.80% 0.83% 4.32% NA
All Indica  2759 98.90% 0.20% 0.14% 0.72% NA
All Japonica  1512 94.70% 4.80% 0.46% 0.00% NA
Aus  269 34.60% 0.00% 8.55% 56.88% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 0.90% 0.22% 0.43% NA
Indica III  913 99.10% 0.00% 0.11% 0.77% NA
Indica Intermediate  786 98.10% 0.30% 0.25% 1.40% NA
Temperate Japonica  767 98.20% 0.90% 0.91% 0.00% NA
Tropical Japonica  504 88.10% 11.90% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 0.00% 5.21% 26.04% NA
Intermediate  90 87.80% 5.60% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523792337 T -> DEL N N silent_mutation Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0523792337 T -> C LOC_Os05g40500.1 upstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0523792337 T -> C LOC_Os05g40530.1 upstream_gene_variant ; 4259.0bp to feature; MODIFIER silent_mutation Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0523792337 T -> C LOC_Os05g40510.1 downstream_gene_variant ; 2333.0bp to feature; MODIFIER silent_mutation Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0523792337 T -> C LOC_Os05g40520.1 downstream_gene_variant ; 642.0bp to feature; MODIFIER silent_mutation Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0523792337 T -> C LOC_Os05g40510-LOC_Os05g40520 intergenic_region ; MODIFIER silent_mutation Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523792337 NA 1.18E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 6.92E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 4.34E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 5.16E-06 1.78E-07 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 9.54E-07 4.35E-08 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 1.47E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 5.89E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 2.40E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 3.40E-07 1.98E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 9.03E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 5.99E-06 2.38E-07 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 3.27E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 NA 6.38E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337 4.33E-07 4.33E-07 mr1448_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251