Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0523792337:

Variant ID: vg0523792337 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23792337
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTTGTGGTCCAAGTTATTTTGTTTTTGTTACCCATGTAATGGGTGGAGCTTCAATGCTTATGTCTGAACTTGGTTGGCTGTGTACATCCCGTTGGA[T/C]
GTAGAGGCCGGGTTTTTAACCCATTATCTAAAAAAAAATTCATCAGATCAGATATCAAATTGCATTCATGTAAATCTGATTTGGAAGCGTTTTCTGCTAC

Reverse complement sequence

GTAGCAGAAAACGCTTCCAAATCAGATTTACATGAATGCAATTTGATATCTGATCTGATGAATTTTTTTTTAGATAATGGGTTAAAAACCCGGCCTCTAC[A/G]
TCCAACGGGATGTACACAGCCAACCAAGTTCAGACATAAGCATTGAAGCTCCACCCATTACATGGGTAACAAAAACAAAATAACTTGGACCACAAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	1.80%	0.83%	4.32%	NA
All Indica	2759	98.90%	0.20%	0.14%	0.72%	NA
All Japonica	1512	94.70%	4.80%	0.46%	0.00%	NA
Aus	269	34.60%	0.00%	8.55%	56.88%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	0.90%	0.22%	0.43%	NA
Indica III	913	99.10%	0.00%	0.11%	0.77%	NA
Indica Intermediate	786	98.10%	0.30%	0.25%	1.40%	NA
Temperate Japonica	767	98.20%	0.90%	0.91%	0.00%	NA
Tropical Japonica	504	88.10%	11.90%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	0.00%	5.21%	26.04%	NA
Intermediate	90	87.80%	5.60%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523792337	T -> DEL	N	N	silent_mutation	Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0523792337	T -> C	LOC_Os05g40500.1	upstream_gene_variant ; 4412.0bp to feature; MODIFIER	silent_mutation	Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0523792337	T -> C	LOC_Os05g40530.1	upstream_gene_variant ; 4259.0bp to feature; MODIFIER	silent_mutation	Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0523792337	T -> C	LOC_Os05g40510.1	downstream_gene_variant ; 2333.0bp to feature; MODIFIER	silent_mutation	Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0523792337	T -> C	LOC_Os05g40520.1	downstream_gene_variant ; 642.0bp to feature; MODIFIER	silent_mutation	Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0523792337	T -> C	LOC_Os05g40510-LOC_Os05g40520	intergenic_region ; MODIFIER	silent_mutation	Average:38.355; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523792337	NA	1.18E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	6.92E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	4.34E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	5.16E-06	1.78E-07	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	9.54E-07	4.35E-08	mr1090_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	1.47E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	5.89E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	2.40E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	3.40E-07	1.98E-10	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	9.03E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	5.99E-06	2.38E-07	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	3.27E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	NA	6.38E-06	mr1253_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523792337	4.33E-07	4.33E-07	mr1448_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251