\
| Variant ID: vg0523768940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23768940 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )
CTTCCGCCCTGATTGTTGGATTAACTTCTCTTTCCATCCCGCTAACCTTGATTGCAACTTGTCCATCACCGGTTGCAGGTGTATTCTCTTGATGCGGCCT[G/A]
GGGTGAGCGGCAATCCCAAATATGTTATGGGAAAATTGCCCCGCTGTCCATTGAAATTTTCTAACACCTCAGACAGGTTCTGCTCTGCGCATTTGATGGA
TCCATCAAATGCGCAGAGCAGAACCTGTCTGAGGTGTTAGAAAATTTCAATGGACAGCGGGGCAATTTTCCCATAACATATTTGGGATTGCCGCTCACCC[C/T]
AGGCCGCATCAAGAGAATACACCTGCAACCGGTGATGGACAAGTTGCAATCAAGGTTAGCGGGATGGAAAGAGAAGTTAATCCAACAATCAGGGCGGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 32.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523768940 | G -> A | LOC_Os05g40460.1 | upstream_gene_variant ; 64.0bp to feature; MODIFIER | silent_mutation | Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0523768940 | G -> A | LOC_Os05g40470.1 | downstream_gene_variant ; 302.0bp to feature; MODIFIER | silent_mutation | Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0523768940 | G -> A | LOC_Os05g40480.1 | downstream_gene_variant ; 2713.0bp to feature; MODIFIER | silent_mutation | Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0523768940 | G -> A | LOC_Os05g40460-LOC_Os05g40470 | intergenic_region ; MODIFIER | silent_mutation | Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523768940 | NA | 5.06E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 1.69E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 3.87E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | 3.48E-06 | NA | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 1.21E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 1.79E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 3.36E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 9.81E-11 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523768940 | NA | 1.31E-12 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |