Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523768940:

Variant ID: vg0523768940 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23768940
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCCGCCCTGATTGTTGGATTAACTTCTCTTTCCATCCCGCTAACCTTGATTGCAACTTGTCCATCACCGGTTGCAGGTGTATTCTCTTGATGCGGCCT[G/A]
GGGTGAGCGGCAATCCCAAATATGTTATGGGAAAATTGCCCCGCTGTCCATTGAAATTTTCTAACACCTCAGACAGGTTCTGCTCTGCGCATTTGATGGA

Reverse complement sequence

TCCATCAAATGCGCAGAGCAGAACCTGTCTGAGGTGTTAGAAAATTTCAATGGACAGCGGGGCAATTTTCCCATAACATATTTGGGATTGCCGCTCACCC[C/T]
AGGCCGCATCAAGAGAATACACCTGCAACCGGTGATGGACAAGTTGCAATCAAGGTTAGCGGGATGGAAAGAGAAGTTAATCCAACAATCAGGGCGGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	5.10%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	32.30%	67.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	32.30%	1.04%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523768940	G -> A	LOC_Os05g40460.1	upstream_gene_variant ; 64.0bp to feature; MODIFIER	silent_mutation	Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0523768940	G -> A	LOC_Os05g40470.1	downstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0523768940	G -> A	LOC_Os05g40480.1	downstream_gene_variant ; 2713.0bp to feature; MODIFIER	silent_mutation	Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0523768940	G -> A	LOC_Os05g40460-LOC_Os05g40470	intergenic_region ; MODIFIER	silent_mutation	Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523768940	NA	5.06E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	1.69E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	3.87E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	3.48E-06	NA	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	1.21E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	1.79E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	3.36E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	9.81E-11	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940	NA	1.31E-12	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251