\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523768940:

Variant ID: vg0523768940 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23768940
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCGCCCTGATTGTTGGATTAACTTCTCTTTCCATCCCGCTAACCTTGATTGCAACTTGTCCATCACCGGTTGCAGGTGTATTCTCTTGATGCGGCCT[G/A]
GGGTGAGCGGCAATCCCAAATATGTTATGGGAAAATTGCCCCGCTGTCCATTGAAATTTTCTAACACCTCAGACAGGTTCTGCTCTGCGCATTTGATGGA

Reverse complement sequence

TCCATCAAATGCGCAGAGCAGAACCTGTCTGAGGTGTTAGAAAATTTCAATGGACAGCGGGGCAATTTTCCCATAACATATTTGGGATTGCCGCTCACCC[C/T]
AGGCCGCATCAAGAGAATACACCTGCAACCGGTGATGGACAAGTTGCAATCAAGGTTAGCGGGATGGAAAGAGAAGTTAATCCAACAATCAGGGCGGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.10% 0.04% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 32.30% 67.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 32.30% 1.04% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523768940 G -> A LOC_Os05g40460.1 upstream_gene_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0523768940 G -> A LOC_Os05g40470.1 downstream_gene_variant ; 302.0bp to feature; MODIFIER silent_mutation Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0523768940 G -> A LOC_Os05g40480.1 downstream_gene_variant ; 2713.0bp to feature; MODIFIER silent_mutation Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0523768940 G -> A LOC_Os05g40460-LOC_Os05g40470 intergenic_region ; MODIFIER silent_mutation Average:43.249; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523768940 NA 5.06E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 1.69E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 3.87E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 3.48E-06 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 1.21E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 1.79E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 3.36E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 9.81E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523768940 NA 1.31E-12 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251