\
| Variant ID: vg0523767761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23767761 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 350. )
AAAGGATGAGAGGTTAAGGCGCTATTCTCGCAAGATTTTTTGCCCCACATGCCGACCATGTATGTATTTCGTCTATTATTCTTGCCGTTAGTTGAGGGAT[T/A]
TGAAGTTCTTTATCTTTGAAAACTCGCATGTTCCTCTCGCACCAGATTTCCCAACTCAAGAGCATGTGCAGTGACTGCATCCCCTTACTTTGACATTTGC
GCAAATGTCAAAGTAAGGGGATGCAGTCACTGCACATGCTCTTGAGTTGGGAAATCTGGTGCGAGAGGAACATGCGAGTTTTCAAAGATAAAGAACTTCA[A/T]
ATCCCTCAACTAACGGCAAGAATAATAGACGAAATACATACATGGTCGGCATGTGGGGCAAAAAATCTTGCGAGAATAGCGCCTTAACCTCTCATCCTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 1.50% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 4.00% | 0.93% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 87.90% | 11.10% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523767761 | T -> A | LOC_Os05g40450.1 | downstream_gene_variant ; 4758.0bp to feature; MODIFIER | silent_mutation | Average:41.135; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0523767761 | T -> A | LOC_Os05g40470.1 | downstream_gene_variant ; 1481.0bp to feature; MODIFIER | silent_mutation | Average:41.135; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0523767761 | T -> A | LOC_Os05g40480.1 | downstream_gene_variant ; 3892.0bp to feature; MODIFIER | silent_mutation | Average:41.135; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0523767761 | T -> A | LOC_Os05g40460.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.135; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523767761 | 1.18E-06 | 2.68E-08 | mr1125 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523767761 | NA | 5.07E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523767761 | NA | 1.25E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523767761 | 1.85E-07 | 9.71E-10 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523767761 | 1.92E-06 | 2.15E-10 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523767761 | 3.16E-06 | 7.98E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523767761 | 9.98E-06 | 9.97E-06 | mr1448_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |