| Variant ID: vg0523764434 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23764434 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 124. )
CACAGAAAATGGAGCAGCGATTAGCGGGTGATTAATTAAGTATTTGTTAATTTTTTTTCAAAAATAGATTAATTTGATTTTTTTAAGTAACTTTCGAATA[G/T]
AAACATTTTACAAAAAACATACCGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAAAACGAGGGAGATGAGTTGGGAAGAGGGGCTGCCGAACACAACCTAA
TTAGGTTGTGTTCGGCAGCCCCTCTTCCCAACTCATCTCCCTCGTTTTCCGCGCGCACGCTTTTCAAACTGCTAAACGGTATGTTTTTTGTAAAATGTTT[C/A]
TATTCGAAAGTTACTTAAAAAAATCAAATTAATCTATTTTTGAAAAAAAATTAACAAATACTTAATTAATCACCCGCTAATCGCTGCTCCATTTTCTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.50% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 92.90% | 5.70% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.00% | 1.34% | 0.00% | NA |
| Indica II | 465 | 73.80% | 22.40% | 3.87% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 6.50% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523764434 | G -> T | LOC_Os05g40440.1 | upstream_gene_variant ; 3508.0bp to feature; MODIFIER | silent_mutation | Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0523764434 | G -> T | LOC_Os05g40450.1 | downstream_gene_variant ; 1431.0bp to feature; MODIFIER | silent_mutation | Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0523764434 | G -> T | LOC_Os05g40460.1 | downstream_gene_variant ; 2061.0bp to feature; MODIFIER | silent_mutation | Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0523764434 | G -> T | LOC_Os05g40470.1 | downstream_gene_variant ; 4808.0bp to feature; MODIFIER | silent_mutation | Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0523764434 | G -> T | LOC_Os05g40450-LOC_Os05g40460 | intergenic_region ; MODIFIER | silent_mutation | Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523764434 | NA | 2.01E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 4.18E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 9.23E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 3.22E-07 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 4.54E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 8.16E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 8.79E-12 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 2.74E-06 | mr1359_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 3.65E-07 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 6.04E-07 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 2.71E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 4.47E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523764434 | NA | 1.15E-08 | mr1654_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |