\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523764434:

Variant ID: vg0523764434 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23764434
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


CACAGAAAATGGAGCAGCGATTAGCGGGTGATTAATTAAGTATTTGTTAATTTTTTTTCAAAAATAGATTAATTTGATTTTTTTAAGTAACTTTCGAATA[G/T]
AAACATTTTACAAAAAACATACCGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAAAACGAGGGAGATGAGTTGGGAAGAGGGGCTGCCGAACACAACCTAA

Reverse complement sequence

TTAGGTTGTGTTCGGCAGCCCCTCTTCCCAACTCATCTCCCTCGTTTTCCGCGCGCACGCTTTTCAAACTGCTAAACGGTATGTTTTTTGTAAAATGTTT[C/A]
TATTCGAAAGTTACTTAAAAAAATCAAATTAATCTATTTTTGAAAAAAAATTAACAAATACTTAATTAATCACCCGCTAATCGCTGCTCCATTTTCTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.50% 0.80% 0.00% NA
All Indica  2759 92.90% 5.70% 1.34% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.70% 0.00% 1.34% 0.00% NA
Indica II  465 73.80% 22.40% 3.87% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 92.20% 6.50% 1.27% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523764434 G -> T LOC_Os05g40440.1 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0523764434 G -> T LOC_Os05g40450.1 downstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0523764434 G -> T LOC_Os05g40460.1 downstream_gene_variant ; 2061.0bp to feature; MODIFIER silent_mutation Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0523764434 G -> T LOC_Os05g40470.1 downstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0523764434 G -> T LOC_Os05g40450-LOC_Os05g40460 intergenic_region ; MODIFIER silent_mutation Average:32.368; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523764434 NA 2.01E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 4.18E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 9.23E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 3.22E-07 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 4.54E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 8.16E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 8.79E-12 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 2.74E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 3.65E-07 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 6.04E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 2.71E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 4.47E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523764434 NA 1.15E-08 mr1654_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251