\
| Variant ID: vg0523735868 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 23735868 |
| Reference Allele: C | Alternative Allele: T,CATAA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAGTTTTAGGTGGTGTTTAGATCTAGGGACTTAACTTTAGTCCCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTA[C/T,CATAA]
ATAAATAAAAGCTAATTCGCGAGATAATTTTTTTAAGCCTAATTAATATATAATTAGAGAATGTTTACTGTAGCATCACATATGCTAATCATGGATTAAT
ATTAATCCATGATTAGCATATGTGATGCTACAGTAAACATTCTCTAATTATATATTAATTAGGCTTAAAAAAATTATCTCGCGAATTAGCTTTTATTTAT[G/A,TTATG]
TAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGGGACTAAAGTTAAGTCCCTAGATCTAAACACCACCTAAAACTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 5.40% | 0.04% | 0.00% | CATAA: 0.97% |
| All Indica | 2759 | 97.10% | 1.20% | 0.07% | 0.00% | CATAA: 1.67% |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.90% | 69.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.40% | 1.50% | 0.11% | 0.00% | CATAA: 4.93% |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.00% | 0.00% | CATAA: 0.13% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523735868 | C -> T | LOC_Os05g40400.1 | upstream_gene_variant ; 3296.0bp to feature; MODIFIER | silent_mutation | Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| vg0523735868 | C -> T | LOC_Os05g40384.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| vg0523735868 | C -> CATAA | LOC_Os05g40400.1 | upstream_gene_variant ; 3295.0bp to feature; MODIFIER | silent_mutation | Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| vg0523735868 | C -> CATAA | LOC_Os05g40384.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523735868 | NA | 3.29E-12 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523735868 | 2.44E-06 | NA | mr1746 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523735868 | NA | 1.91E-07 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523735868 | 5.02E-06 | NA | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523735868 | NA | 1.72E-11 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523735868 | 9.28E-07 | NA | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |