\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523735868:

Variant ID: vg0523735868 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 23735868
Reference Allele: CAlternative Allele: T,CATAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTTTAGGTGGTGTTTAGATCTAGGGACTTAACTTTAGTCCCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTA[C/T,CATAA]
ATAAATAAAAGCTAATTCGCGAGATAATTTTTTTAAGCCTAATTAATATATAATTAGAGAATGTTTACTGTAGCATCACATATGCTAATCATGGATTAAT

Reverse complement sequence

ATTAATCCATGATTAGCATATGTGATGCTACAGTAAACATTCTCTAATTATATATTAATTAGGCTTAAAAAAATTATCTCGCGAATTAGCTTTTATTTAT[G/A,TTATG]
TAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGGGACTAAAGTTAAGTCCCTAGATCTAAACACCACCTAAAACTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 5.40% 0.04% 0.00% CATAA: 0.97%
All Indica  2759 97.10% 1.20% 0.07% 0.00% CATAA: 1.67%
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 93.40% 1.50% 0.11% 0.00% CATAA: 4.93%
Indica Intermediate  786 98.00% 1.90% 0.00% 0.00% CATAA: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523735868 C -> T LOC_Os05g40400.1 upstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0523735868 C -> T LOC_Os05g40384.1 intron_variant ; MODIFIER silent_mutation Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0523735868 C -> CATAA LOC_Os05g40400.1 upstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0523735868 C -> CATAA LOC_Os05g40384.1 intron_variant ; MODIFIER silent_mutation Average:62.416; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523735868 NA 3.29E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523735868 2.44E-06 NA mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523735868 NA 1.91E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523735868 5.02E-06 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523735868 NA 1.72E-11 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523735868 9.28E-07 NA mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251