Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523699793:

Variant ID: vg0523699793 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23699793
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:

TAATGCCGAGATAAGGACAAGTGGTATATTTCCAATGTTCCCTGCATTAAGTGAAATGTTAAAAATATAATGCAGAATGCGTGATGAATCAGAAGCTAGC[G/A]
ATATTCATAAGGGCGTGAGGAATGTACAAACCTATTCCAATGTGAGTGATGGTGAACTTGAAGTATGGATAAGGCGGCCGTACAATCAATGCCACTATAA

Reverse complement sequence

TTATAGTGGCATTGATTGTACGGCCGCCTTATCCATACTTCAAGTTCACCATCACTCACATTGGAATAGGTTTGTACATTCCTCACGCCCTTATGAATAT[C/T]
GCTAGCTTCTGATTCATCACGCATTCTGCATTATATTTTTAACATTTCACTTAATGCAGGGAACATTGGAAATATACCACTTGTCCTTATCTCGGCATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	9.40%	0.21%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.04%	0.00%	NA
All Japonica	1512	70.50%	28.90%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	95.30%	4.40%	0.26%	0.00%	NA
Tropical Japonica	504	31.20%	67.70%	1.19%	0.00%	NA
Japonica Intermediate	241	73.90%	25.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523699793	G -> A	LOC_Os05g40320.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:56.275; most accessible tissue: Callus, score: 85.162	N	N	N	N
vg0523699793	G -> A	LOC_Os05g40330.1	intron_variant ; MODIFIER	silent_mutation	Average:56.275; most accessible tissue: Callus, score: 85.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523699793	3.91E-06	NA	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	4.02E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	5.75E-20	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	1.09E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	1.57E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	1.31E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	1.53E-31	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	7.43E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	3.41E-06	NA	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	2.68E-21	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	1.63E-17	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	1.86E-11	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	3.95E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	2.16E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	2.82E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	7.46E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	5.59E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793	NA	2.37E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251