Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523699793:

Variant ID: vg0523699793 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23699793
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGCCGAGATAAGGACAAGTGGTATATTTCCAATGTTCCCTGCATTAAGTGAAATGTTAAAAATATAATGCAGAATGCGTGATGAATCAGAAGCTAGC[G/A]
ATATTCATAAGGGCGTGAGGAATGTACAAACCTATTCCAATGTGAGTGATGGTGAACTTGAAGTATGGATAAGGCGGCCGTACAATCAATGCCACTATAA

Reverse complement sequence

TTATAGTGGCATTGATTGTACGGCCGCCTTATCCATACTTCAAGTTCACCATCACTCACATTGGAATAGGTTTGTACATTCCTCACGCCCTTATGAATAT[C/T]
GCTAGCTTCTGATTCATCACGCATTCTGCATTATATTTTTAACATTTCACTTAATGCAGGGAACATTGGAAATATACCACTTGTCCTTATCTCGGCATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.40% 0.21% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 70.50% 28.90% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 95.30% 4.40% 0.26% 0.00% NA
Tropical Japonica  504 31.20% 67.70% 1.19% 0.00% NA
Japonica Intermediate  241 73.90% 25.70% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523699793 G -> A LOC_Os05g40320.1 downstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:56.275; most accessible tissue: Callus, score: 85.162 N N N N
vg0523699793 G -> A LOC_Os05g40330.1 intron_variant ; MODIFIER silent_mutation Average:56.275; most accessible tissue: Callus, score: 85.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523699793 3.91E-06 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 4.02E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 5.75E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 1.09E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 1.57E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 1.31E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 1.53E-31 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 7.43E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 3.41E-06 NA mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 2.68E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 1.63E-17 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 1.86E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 3.95E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 2.16E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 2.82E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 7.46E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 5.59E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523699793 NA 2.37E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251