\
| Variant ID: vg0523543573 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23543573 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 126. )
TAAAAACTATAAAATTAGAAATAGGAGGATGATAAGATTTGGTTTTTCAAAATCTTAAGACAACGAGATAACTATTTAATAAATTTGAAATAAAATCATA[T/C]
TAAAATATATATAATTTTATATTGGTGCTAGCAGTGCAATTGCGCGGGTCACCCAGCTAGTTATATTATTAAAACAGCTTTGAAAGGAGTCACCACGTTC
GAACGTGGTGACTCCTTTCAAAGCTGTTTTAATAATATAACTAGCTGGGTGACCCGCGCAATTGCACTGCTAGCACCAATATAAAATTATATATATTTTA[A/G]
TATGATTTTATTTCAAATTTATTAAATAGTTATCTCGTTGTCTTAAGATTTTGAAAAACCAAATCTTATCATCCTCCTATTTCTAATTTTATAGTTTTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 12.60% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 4.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 68.70% | 30.80% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.80% | 8.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.70% | 66.90% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 36.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523543573 | T -> C | LOC_Os05g40070.1 | upstream_gene_variant ; 4560.0bp to feature; MODIFIER | silent_mutation | Average:14.898; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0523543573 | T -> C | LOC_Os05g40070-LOC_Os05g40080 | intergenic_region ; MODIFIER | silent_mutation | Average:14.898; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523543573 | NA | 7.40E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 2.17E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | 2.14E-06 | NA | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | 1.31E-06 | 1.31E-06 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 2.96E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 3.29E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 3.93E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 5.94E-08 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 8.66E-07 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523543573 | NA | 1.48E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |