\
| Variant ID: vg0523519263 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23519263 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, G: 0.08, others allele: 0.00, population size: 218. )
GCTCCATTTGTGTTACCAGGTAAACATAACCTATAGCAATCCAAATGGTGTAGAAATTACAGTAAAATCTGGGAAGGGGCAGTGTTCCTTACACACCAAG[C/G]
AAACAGTTTTTGATTGGCAACAACAGTTTCAGCAGTTTGCAGCTTATGCAACACGCGCGAATCCAATCTACGGAGCCTCCTTCCTTGTTTTCACTGTTGT
ACAACAGTGAAAACAAGGAAGGAGGCTCCGTAGATTGGATTCGCGCGTGTTGCATAAGCTGCAAACTGCTGAAACTGTTGTTGCCAATCAAAAACTGTTT[G/C]
CTTGGTGTGTAAGGAACACTGCCCCTTCCCAGATTTTACTGTAATTTCTACACCATTTGGATTGCTATAGGTTATGTTTACCTGGTAACACAAATGGAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.60% | 36.90% | 0.30% | 0.21% | NA |
| All Indica | 2759 | 94.80% | 4.60% | 0.29% | 0.29% | NA |
| All Japonica | 1512 | 0.40% | 99.30% | 0.26% | 0.07% | NA |
| Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.50% | 0.34% | 0.50% | NA |
| Indica II | 465 | 93.80% | 6.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 92.60% | 7.00% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 95.90% | 3.30% | 0.38% | 0.38% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 99.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 44.40% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523519263 | C -> DEL | LOC_Os05g40040.1 | N | frameshift_variant | Average:62.318; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0523519263 | C -> G | LOC_Os05g40040.1 | missense_variant ; p.Gln243Glu; MODERATE | nonsynonymous_codon ; Q243E | Average:62.318; most accessible tissue: Minghui63 panicle, score: 82.797 | unknown | unknown | TOLERATED | 0.10 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523519263 | NA | 1.92E-46 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.38E-27 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 3.61E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.77E-30 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 4.87E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 5.19E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 2.13E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.31E-38 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 3.31E-23 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.19E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | 9.10E-07 | NA | mr1940 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 4.92E-18 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 3.20E-28 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.80E-25 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 2.30E-67 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.55E-31 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 2.08E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 1.02E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523519263 | NA | 4.41E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |