\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523498004:

Variant ID: vg0523498004 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23498004
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGTGAAGTGGCGCGCGTGCGGGGGCCCCGCCCACATGGCTCTCGCTAGCCGCAGACGGGAACCATGCGCTGCAAGCCTGCAACTGGCGCCGCGGCGCG[T/C]
GTGGACCATAAGCAGATGGGCGCCCGCGCCGCTGCGCGGTGCGCGGTGCGCTTGGGCGCGCGGCTCGAACGATCGATCGGCTCGGGTGGTGTCGCGCGCG

Reverse complement sequence

CGCGCGCGACACCACCCGAGCCGATCGATCGTTCGAGCCGCGCGCCCAAGCGCACCGCGCACCGCGCAGCGGCGCGGGCGCCCATCTGCTTATGGTCCAC[A/G]
CGCGCCGCGGCGCCAGTTGCAGGCTTGCAGCGCATGGTTCCCGTCTGCGGCTAGCGAGAGCCATGTGGGCGGGGCCCCCGCACGCGCGCCACTTCACCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 21.80% 0.08% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 37.70% 62.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 6.00% 93.50% 0.52% 0.00% NA
Tropical Japonica  504 83.10% 16.90% 0.00% 0.00% NA
Japonica Intermediate  241 43.60% 56.40% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523498004 T -> C LOC_Os05g39990.1 upstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:98.126; most accessible tissue: Zhenshan97 flower, score: 99.969 N N N N
vg0523498004 T -> C LOC_Os05g40000.1 downstream_gene_variant ; 4663.0bp to feature; MODIFIER silent_mutation Average:98.126; most accessible tissue: Zhenshan97 flower, score: 99.969 N N N N
vg0523498004 T -> C LOC_Os05g39990-LOC_Os05g40000 intergenic_region ; MODIFIER silent_mutation Average:98.126; most accessible tissue: Zhenshan97 flower, score: 99.969 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0523498004 T C -0.09 -0.11 -0.05 -0.1 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523498004 2.51E-10 8.88E-46 Grain_thickness All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0523498004 NA 2.75E-17 Grain_thickness Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0523498004 NA 7.36E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0523498004 NA 1.72E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 4.19E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 7.97E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 4.28E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 3.23E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 2.34E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 4.38E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 2.96E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 3.17E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 1.42E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 1.34E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 3.56E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 1.31E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 4.28E-24 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 1.70E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 4.88E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523498004 NA 3.44E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251