\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523455096:

Variant ID: vg0523455096 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23455096
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGATGAATGACATATTTTCAAACCCAAATCAACTTAAGACTTTATATATCTCAATATCATTTTCACTGATGTCCAATGTTCAACTGTTGGACTATG[C/T]
AAAAATTGACAAACCTTGTTCACTGAGAAGGAAATATCAGGTCTGGTTAAAGTCAAATATTGCAAAGCTCCAACTATACTTCTATATTTAGTTGCATCAT

Reverse complement sequence

ATGATGCAACTAAATATAGAAGTATAGTTGGAGCTTTGCAATATTTGACTTTAACCAGACCTGATATTTCCTTCTCAGTGAACAAGGTTTGTCAATTTTT[G/A]
CATAGTCCAACAGTTGAACATTGGACATCAGTGAAAATGATATTGAGATATATAAAGTCTTAAGTTGATTTGGGTTTGAAAATATGTCATTCATCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 42.70% 0.19% 0.28% NA
All Indica  2759 92.00% 7.40% 0.29% 0.29% NA
All Japonica  1512 0.50% 99.10% 0.07% 0.26% NA
Aus  269 34.20% 65.80% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.17% 0.17% NA
Indica II  465 93.50% 6.20% 0.00% 0.22% NA
Indica III  913 84.40% 15.10% 0.00% 0.44% NA
Indica Intermediate  786 94.30% 4.60% 0.89% 0.25% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 0.60% 99.00% 0.00% 0.40% NA
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.83% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523455096 C -> T LOC_Os05g39910.1 downstream_gene_variant ; 2489.0bp to feature; MODIFIER silent_mutation Average:39.74; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg0523455096 C -> T LOC_Os05g39920.1 intron_variant ; MODIFIER silent_mutation Average:39.74; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg0523455096 C -> DEL N N silent_mutation Average:39.74; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523455096 NA 3.17E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 9.62E-48 mr1109 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 1.22E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 5.01E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 1.84E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 1.32E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 2.46E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 6.78E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 7.90E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 5.19E-58 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 5.07E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 3.69E-81 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 4.16E-30 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 3.91E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 8.61E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 1.49E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 3.78E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 2.96E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 7.33E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 1.55E-61 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 2.00E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 1.68E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523455096 NA 6.29E-48 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251