Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523302726:

Variant ID: vg0523302726 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23302726
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCATGCGTGGTGCTTTTGGTACATATTTTCATTTTTAAGTTAGAGTTAGTCTTTTCGTCCCACAAAAAACCAATCTAGCATTGGATGAGATGTTTTCTA[G/A]
TACAATGAATTTGGACAAGAGTATATCCAGATACGTTGTACTAGGAAACGTTTAATCCAATACTAGTTTAAATTTTTTTTGGACGGAGGGAGTATATAAC

Reverse complement sequence

GTTATATACTCCCTCCGTCCAAAAAAAATTTAAACTAGTATTGGATTAAACGTTTCCTAGTACAACGTATCTGGATATACTCTTGTCCAAATTCATTGTA[C/T]
TAGAAAACATCTCATCCAATGCTAGATTGGTTTTTTGTGGGACGAAAAGACTAACTCTAACTTAAAAATGAAAATATGTACCAAAAGCACCACGCATGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.30%	0.63%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	72.70%	25.50%	1.85%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	0.50%	0.78%	0.00%	NA
Tropical Japonica	504	40.10%	57.10%	2.78%	0.00%	NA
Japonica Intermediate	241	58.10%	38.60%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523302726	G -> A	LOC_Os05g39700.1	upstream_gene_variant ; 881.0bp to feature; MODIFIER	silent_mutation	Average:65.757; most accessible tissue: Callus, score: 82.533	N	N	N	N
vg0523302726	G -> A	LOC_Os05g39710.1	upstream_gene_variant ; 4721.0bp to feature; MODIFIER	silent_mutation	Average:65.757; most accessible tissue: Callus, score: 82.533	N	N	N	N
vg0523302726	G -> A	LOC_Os05g39690.1	downstream_gene_variant ; 2254.0bp to feature; MODIFIER	silent_mutation	Average:65.757; most accessible tissue: Callus, score: 82.533	N	N	N	N
vg0523302726	G -> A	LOC_Os05g39690-LOC_Os05g39700	intergenic_region ; MODIFIER	silent_mutation	Average:65.757; most accessible tissue: Callus, score: 82.533	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523302726	8.97E-07	NA	mr1064	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	4.10E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	2.85E-06	mr1534	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	5.54E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	8.77E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	4.88E-07	NA	mr1064_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	1.02E-07	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	3.16E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	5.53E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	3.21E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	7.53E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	5.20E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	1.54E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	7.87E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726	NA	2.22E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251