\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523302726:

Variant ID: vg0523302726 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23302726
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCATGCGTGGTGCTTTTGGTACATATTTTCATTTTTAAGTTAGAGTTAGTCTTTTCGTCCCACAAAAAACCAATCTAGCATTGGATGAGATGTTTTCTA[G/A]
TACAATGAATTTGGACAAGAGTATATCCAGATACGTTGTACTAGGAAACGTTTAATCCAATACTAGTTTAAATTTTTTTTGGACGGAGGGAGTATATAAC

Reverse complement sequence

GTTATATACTCCCTCCGTCCAAAAAAAATTTAAACTAGTATTGGATTAAACGTTTCCTAGTACAACGTATCTGGATATACTCTTGTCCAAATTCATTGTA[C/T]
TAGAAAACATCTCATCCAATGCTAGATTGGTTTTTTGTGGGACGAAAAGACTAACTCTAACTTAAAAATGAAAATATGTACCAAAAGCACCACGCATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.30% 0.63% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 72.70% 25.50% 1.85% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 0.50% 0.78% 0.00% NA
Tropical Japonica  504 40.10% 57.10% 2.78% 0.00% NA
Japonica Intermediate  241 58.10% 38.60% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523302726 G -> A LOC_Os05g39700.1 upstream_gene_variant ; 881.0bp to feature; MODIFIER silent_mutation Average:65.757; most accessible tissue: Callus, score: 82.533 N N N N
vg0523302726 G -> A LOC_Os05g39710.1 upstream_gene_variant ; 4721.0bp to feature; MODIFIER silent_mutation Average:65.757; most accessible tissue: Callus, score: 82.533 N N N N
vg0523302726 G -> A LOC_Os05g39690.1 downstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:65.757; most accessible tissue: Callus, score: 82.533 N N N N
vg0523302726 G -> A LOC_Os05g39690-LOC_Os05g39700 intergenic_region ; MODIFIER silent_mutation Average:65.757; most accessible tissue: Callus, score: 82.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523302726 8.97E-07 NA mr1064 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 4.10E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 2.85E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 5.54E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 8.77E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 4.88E-07 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 1.02E-07 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 3.16E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 5.53E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 3.21E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 7.53E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 5.20E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 1.54E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 7.87E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523302726 NA 2.22E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251