\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523273054:

Variant ID: vg0523273054 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23273054
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGTCACGCACAAAGTATTAATCATGTTTTATCATCTAACAACAATAAAAATACGAATTATAAAAAAATTTCATACAAGACGGACACGAAAACCTAGG[A/G]
TTTGCATTTTTTTTTGACGGAGGAAGTACATGTTATGACCATGTGATTAGTTAACAGCCTAACTTGCAATACTGTTTATTAGTCCCGTTGAACTGTAACA

Reverse complement sequence

TGTTACAGTTCAACGGGACTAATAAACAGTATTGCAAGTTAGGCTGTTAACTAATCACATGGTCATAACATGTACTTCCTCCGTCAAAAAAAAATGCAAA[T/C]
CCTAGGTTTTCGTGTCCGTCTTGTATGAAATTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGATAAAACATGATTAATACTTTGTGCGTGACTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 38.50% 0.19% 3.72% NA
All Indica  2759 90.60% 8.40% 0.18% 0.80% NA
All Japonica  1512 1.60% 98.30% 0.07% 0.07% NA
Aus  269 51.70% 3.70% 0.37% 44.24% NA
Indica I  595 92.90% 5.70% 0.17% 1.18% NA
Indica II  465 93.10% 6.20% 0.22% 0.43% NA
Indica III  913 87.60% 11.80% 0.11% 0.44% NA
Indica Intermediate  786 90.70% 7.90% 0.25% 1.15% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 95.40% 0.41% 0.41% NA
VI/Aromatic  96 9.40% 59.40% 0.00% 31.25% NA
Intermediate  90 54.40% 38.90% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523273054 A -> DEL N N silent_mutation Average:71.724; most accessible tissue: Callus, score: 89.172 N N N N
vg0523273054 A -> G LOC_Os05g39620.1 upstream_gene_variant ; 4819.0bp to feature; MODIFIER silent_mutation Average:71.724; most accessible tissue: Callus, score: 89.172 N N N N
vg0523273054 A -> G LOC_Os05g39630.1 downstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:71.724; most accessible tissue: Callus, score: 89.172 N N N N
vg0523273054 A -> G LOC_Os05g39640.1 downstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:71.724; most accessible tissue: Callus, score: 89.172 N N N N
vg0523273054 A -> G LOC_Os05g39650.1 downstream_gene_variant ; 304.0bp to feature; MODIFIER silent_mutation Average:71.724; most accessible tissue: Callus, score: 89.172 N N N N
vg0523273054 A -> G LOC_Os05g39640-LOC_Os05g39650 intergenic_region ; MODIFIER silent_mutation Average:71.724; most accessible tissue: Callus, score: 89.172 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523273054 NA 4.28E-11 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0523273054 NA 2.52E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.90E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 6.25E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.37E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 3.46E-42 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 2.26E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 2.29E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.24E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 3.93E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 8.15E-54 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.85E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 1.30E-06 NA mr1750 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 8.53E-37 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.39E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 5.90E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 4.71E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.26E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.46E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.98E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 8.11E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 7.41E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 1.35E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 4.68E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054 NA 4.15E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251