Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523273054:

Variant ID: vg0523273054 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23273054
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAGTCACGCACAAAGTATTAATCATGTTTTATCATCTAACAACAATAAAAATACGAATTATAAAAAAATTTCATACAAGACGGACACGAAAACCTAGG[A/G]
TTTGCATTTTTTTTTGACGGAGGAAGTACATGTTATGACCATGTGATTAGTTAACAGCCTAACTTGCAATACTGTTTATTAGTCCCGTTGAACTGTAACA

Reverse complement sequence

TGTTACAGTTCAACGGGACTAATAAACAGTATTGCAAGTTAGGCTGTTAACTAATCACATGGTCATAACATGTACTTCCTCCGTCAAAAAAAAATGCAAA[T/C]
CCTAGGTTTTCGTGTCCGTCTTGTATGAAATTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGATAAAACATGATTAATACTTTGTGCGTGACTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	38.50%	0.19%	3.72%	NA
All Indica	2759	90.60%	8.40%	0.18%	0.80%	NA
All Japonica	1512	1.60%	98.30%	0.07%	0.07%	NA
Aus	269	51.70%	3.70%	0.37%	44.24%	NA
Indica I	595	92.90%	5.70%	0.17%	1.18%	NA
Indica II	465	93.10%	6.20%	0.22%	0.43%	NA
Indica III	913	87.60%	11.80%	0.11%	0.44%	NA
Indica Intermediate	786	90.70%	7.90%	0.25%	1.15%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	98.00%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	95.40%	0.41%	0.41%	NA
VI/Aromatic	96	9.40%	59.40%	0.00%	31.25%	NA
Intermediate	90	54.40%	38.90%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523273054	A -> DEL	N	N	silent_mutation	Average:71.724; most accessible tissue: Callus, score: 89.172	N	N	N	N
vg0523273054	A -> G	LOC_Os05g39620.1	upstream_gene_variant ; 4819.0bp to feature; MODIFIER	silent_mutation	Average:71.724; most accessible tissue: Callus, score: 89.172	N	N	N	N
vg0523273054	A -> G	LOC_Os05g39630.1	downstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:71.724; most accessible tissue: Callus, score: 89.172	N	N	N	N
vg0523273054	A -> G	LOC_Os05g39640.1	downstream_gene_variant ; 362.0bp to feature; MODIFIER	silent_mutation	Average:71.724; most accessible tissue: Callus, score: 89.172	N	N	N	N
vg0523273054	A -> G	LOC_Os05g39650.1	downstream_gene_variant ; 304.0bp to feature; MODIFIER	silent_mutation	Average:71.724; most accessible tissue: Callus, score: 89.172	N	N	N	N
vg0523273054	A -> G	LOC_Os05g39640-LOC_Os05g39650	intergenic_region ; MODIFIER	silent_mutation	Average:71.724; most accessible tissue: Callus, score: 89.172	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523273054	NA	4.28E-11	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0523273054	NA	2.52E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.90E-44	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	6.25E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.37E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	3.46E-42	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	2.26E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	2.29E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.24E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	3.93E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	8.15E-54	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.85E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	1.30E-06	NA	mr1750	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	8.53E-37	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.39E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	5.90E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	4.71E-17	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.26E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.46E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.98E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	8.11E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	7.41E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	1.35E-11	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	4.68E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523273054	NA	4.15E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251