\
| Variant ID: vg0523235966 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23235966 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )
AAAAAACCTGAAGCTTACAGAAATTACGGTGGCTAAAACAGACTCCAAGCAGCGGGAAGGGGCTAAGCCATGCTAAACTCCCAACAAATCCCCAAAAGCA[G/A]
CGACGCCAGCTAAAGACCACAGATGGCCCTCCACATGGACGGACTCCAAAACCACTGTGACCGAAGAGAGAGCGGAGTCGAAAACCCTAGAGTTCCGCTC
GAGCGGAACTCTAGGGTTTTCGACTCCGCTCTCTCTTCGGTCACAGTGGTTTTGGAGTCCGTCCATGTGGAGGGCCATCTGTGGTCTTTAGCTGGCGTCG[C/T]
TGCTTTTGGGGATTTGTTGGGAGTTTAGCATGGCTTAGCCCCTTCCCGCTGCTTGGAGTCTGTTTTAGCCACCGTAATTTCTGTAAGCTTCAGGTTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 47.00% | 0.08% | 0.97% | NA |
| All Indica | 2759 | 30.50% | 67.80% | 0.07% | 1.59% | NA |
| All Japonica | 1512 | 98.50% | 1.40% | 0.00% | 0.07% | NA |
| Aus | 269 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.50% | 78.30% | 0.00% | 2.18% | NA |
| Indica II | 465 | 20.40% | 77.80% | 0.00% | 1.72% | NA |
| Indica III | 913 | 43.20% | 56.00% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 30.20% | 67.70% | 0.25% | 1.91% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 34.40% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523235966 | G -> DEL | N | N | silent_mutation | Average:48.651; most accessible tissue: Zhenshan97 young leaf, score: 77.736 | N | N | N | N |
| vg0523235966 | G -> A | LOC_Os05g39580.1 | downstream_gene_variant ; 3236.0bp to feature; MODIFIER | silent_mutation | Average:48.651; most accessible tissue: Zhenshan97 young leaf, score: 77.736 | N | N | N | N |
| vg0523235966 | G -> A | LOC_Os05g39570-LOC_Os05g39580 | intergenic_region ; MODIFIER | silent_mutation | Average:48.651; most accessible tissue: Zhenshan97 young leaf, score: 77.736 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523235966 | NA | 1.06E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 2.45E-14 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 1.24E-13 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 4.64E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 5.43E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | 4.66E-06 | 4.66E-06 | mr1537_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 1.62E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 3.31E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 1.01E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 2.02E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | 5.17E-06 | 5.17E-06 | mr1727_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 3.80E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | 2.68E-06 | 1.02E-06 | mr1890_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523235966 | NA | 1.99E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |