\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523235966:

Variant ID: vg0523235966 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23235966
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAACCTGAAGCTTACAGAAATTACGGTGGCTAAAACAGACTCCAAGCAGCGGGAAGGGGCTAAGCCATGCTAAACTCCCAACAAATCCCCAAAAGCA[G/A]
CGACGCCAGCTAAAGACCACAGATGGCCCTCCACATGGACGGACTCCAAAACCACTGTGACCGAAGAGAGAGCGGAGTCGAAAACCCTAGAGTTCCGCTC

Reverse complement sequence

GAGCGGAACTCTAGGGTTTTCGACTCCGCTCTCTCTTCGGTCACAGTGGTTTTGGAGTCCGTCCATGTGGAGGGCCATCTGTGGTCTTTAGCTGGCGTCG[C/T]
TGCTTTTGGGGATTTGTTGGGAGTTTAGCATGGCTTAGCCCCTTCCCGCTGCTTGGAGTCTGTTTTAGCCACCGTAATTTCTGTAAGCTTCAGGTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 47.00% 0.08% 0.97% NA
All Indica  2759 30.50% 67.80% 0.07% 1.59% NA
All Japonica  1512 98.50% 1.40% 0.00% 0.07% NA
Aus  269 3.70% 96.30% 0.00% 0.00% NA
Indica I  595 19.50% 78.30% 0.00% 2.18% NA
Indica II  465 20.40% 77.80% 0.00% 1.72% NA
Indica III  913 43.20% 56.00% 0.00% 0.88% NA
Indica Intermediate  786 30.20% 67.70% 0.25% 1.91% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523235966 G -> DEL N N silent_mutation Average:48.651; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0523235966 G -> A LOC_Os05g39580.1 downstream_gene_variant ; 3236.0bp to feature; MODIFIER silent_mutation Average:48.651; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0523235966 G -> A LOC_Os05g39570-LOC_Os05g39580 intergenic_region ; MODIFIER silent_mutation Average:48.651; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523235966 NA 1.06E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 2.45E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 1.24E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 4.64E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 5.43E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 4.66E-06 4.66E-06 mr1537_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 1.62E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 3.31E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 1.01E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 2.02E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 5.17E-06 5.17E-06 mr1727_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 3.80E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 2.68E-06 1.02E-06 mr1890_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523235966 NA 1.99E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251