Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0523229276:

Variant ID: vg0523229276 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23229276
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAAAAAAAAAAGGTCAGCTCGATCTTTAGTCCCGGTTGGTGTTACCAACCGGGACTAAAGATAGCGATCTTTAGTCCCGGATTGGTAGTCCCGGTTTG[G/A]
AAACCGGGACTAAAGGGGGGTTACGAACCGGGACTACAAAGGGTTTCTCCACCAGTGATAATACCTAATGTGACACGCTAAAATTTTACACCCCTACATC

Reverse complement sequence

GATGTAGGGGTGTAAAATTTTAGCGTGTCACATTAGGTATTATCACTGGTGGAGAAACCCTTTGTAGTCCCGGTTCGTAACCCCCCTTTAGTCCCGGTTT[C/T]
CAAACCGGGACTACCAATCCGGGACTAAAGATCGCTATCTTTAGTCCCGGTTGGTAACACCAACCGGGACTAAAGATCGAGCTGACCTTTTTTTTTTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	1.20%	2.58%	42.55%	NA
All Indica	2759	35.00%	0.00%	3.12%	61.83%	NA
All Japonica	1512	94.20%	3.80%	1.12%	0.93%	NA
Aus	269	7.80%	0.00%	5.95%	86.25%	NA
Indica I	595	25.00%	0.00%	0.84%	74.12%	NA
Indica II	465	26.00%	0.00%	2.37%	71.61%	NA
Indica III	913	45.00%	0.00%	6.57%	48.41%	NA
Indica Intermediate	786	36.40%	0.00%	1.27%	62.34%	NA
Temperate Japonica	767	91.00%	7.00%	1.69%	0.26%	NA
Tropical Japonica	504	98.00%	0.00%	0.20%	1.79%	NA
Japonica Intermediate	241	96.30%	1.20%	1.24%	1.24%	NA
VI/Aromatic	96	62.50%	1.00%	2.08%	34.38%	NA
Intermediate	90	70.00%	0.00%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523229276	G -> DEL	N	N	silent_mutation	Average:54.603; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg0523229276	G -> A	LOC_Os05g39570.1	downstream_gene_variant ; 405.0bp to feature; MODIFIER	silent_mutation	Average:54.603; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg0523229276	G -> A	LOC_Os05g39570-LOC_Os05g39580	intergenic_region ; MODIFIER	silent_mutation	Average:54.603; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523229276	1.19E-06	NA	mr1101	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251