\
| Variant ID: vg0523087948 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23087948 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCGCGCCAACGAGGCGCACCACCGCGACGTCAACCATTTCGCATCGGTACGTGCGTGCGTGTGGATTCCCAAGCTTGATGTGTGCTTTGTGTAGGTTTG[A/T]
GATGACTGAATTATTTTTGCTTGTGATGTGCATGCAGGATGTCCATTTCCAGGGGATGGATCTCAAGGATACGCCTGCCCCGCTCGATTATCACTGATGA
TCATCAGTGATAATCGAGCGGGGCAGGCGTATCCTTGAGATCCATCCCCTGGAAATGGACATCCTGCATGCACATCACAAGCAAAAATAATTCAGTCATC[T/A]
CAAACCTACACAAAGCACACATCAAGCTTGGGAATCCACACGCACGCACGTACCGATGCGAAATGGTTGACGTCGCGGTGGTGCGCCTCGTTGGCGCGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.70% | 33.80% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 0.00% | 7.06% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 56.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523087948 | A -> T | LOC_Os05g39350.1 | upstream_gene_variant ; 4187.0bp to feature; MODIFIER | silent_mutation | Average:66.667; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0523087948 | A -> T | LOC_Os05g39370.1 | upstream_gene_variant ; 1549.0bp to feature; MODIFIER | silent_mutation | Average:66.667; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0523087948 | A -> T | LOC_Os05g39360.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.667; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523087948 | NA | 1.62E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0523087948 | NA | 4.39E-54 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0523087948 | NA | 2.55E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 2.16E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 1.22E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 3.98E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 1.64E-40 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 9.83E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 2.68E-13 | mr1579 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 3.76E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 4.95E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 4.15E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 8.33E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 3.41E-30 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 4.72E-24 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 1.93E-44 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523087948 | NA | 1.83E-65 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |