\
| Variant ID: vg0523054357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23054357 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 30. )
TGCGGCGGCGGCCGTGCGGCAGCGGCGGAGCGAGGCGGCTGTGCGGCAGGCGGCCAGCGGCAGCGGCAGCCCATTTGCATATTTGTGTGGATAATTTTGT[G/A]
ATTCATTGCATGTTTGTATGGATCTGTGATGTATTTGATATGTTTGTAATTTTTGTAGGATTTGTGATGTATTTGATTTGTGTGTATAAGTAACTTTAAG
CTTAAAGTTACTTATACACACAAATCAAATACATCACAAATCCTACAAAAATTACAAACATATCAAATACATCACAGATCCATACAAACATGCAATGAAT[C/T]
ACAAAATTATCCACACAAATATGCAAATGGGCTGCCGCTGCCGCTGGCCGCCTGCCGCACAGCCGCCTCGCTCCGCCGCTGCCGCACGGCCGCCGCCGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.10% | 0.30% | 4.25% | 14.41% | NA |
| All Indica | 2759 | 70.20% | 0.50% | 6.05% | 23.23% | NA |
| All Japonica | 1512 | 99.40% | 0.00% | 0.13% | 0.46% | NA |
| Aus | 269 | 82.50% | 0.00% | 9.29% | 8.18% | NA |
| Indica I | 595 | 58.70% | 0.70% | 6.72% | 33.95% | NA |
| Indica II | 465 | 63.20% | 0.90% | 8.39% | 27.53% | NA |
| Indica III | 913 | 81.40% | 0.10% | 3.83% | 14.68% | NA |
| Indica Intermediate | 786 | 70.20% | 0.50% | 6.74% | 22.52% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 7.78% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523054357 | G -> DEL | N | N | silent_mutation | Average:32.566; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0523054357 | G -> A | LOC_Os05g39310.1 | upstream_gene_variant ; 4580.0bp to feature; MODIFIER | silent_mutation | Average:32.566; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0523054357 | G -> A | LOC_Os05g39300-LOC_Os05g39310 | intergenic_region ; MODIFIER | silent_mutation | Average:32.566; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523054357 | 2.33E-06 | 5.89E-06 | mr1166 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523054357 | NA | 7.21E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523054357 | NA | 9.23E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523054357 | NA | 8.57E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523054357 | NA | 1.88E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523054357 | NA | 6.13E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523054357 | NA | 1.09E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |