Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523014690:

Variant ID: vg0523014690 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 23014690
Reference Allele: TTC	Alternative Allele: CTC,T
Primary Allele: TTC	Secondary Allele: CTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTACCTGTTTAGAAGGATGAGGTTATTACCTGTTTTGTTTGGTTGGGAGACATGAAAATTTTGATGGGATGGAGATGGGGAATTGAGGAAGGAACTCT[TTC/CTC,T]
CTTTTCAATACCTTGGTAGGGGTGGTAATTTGGAGGGAATTCCTCATTTACTTTACCTAAACAAATCTCAGCTAACCGTTTTCATTAATGACCTAATCTC

Reverse complement sequence

GAGATTAGGTCATTAATGAAAACGGTTAGCTGAGATTTGTTTAGGTAAAGTAAATGAGGAATTCCCTCCAAATTACCACCCCTACCAAGGTATTGAAAAG[GAA/GAG,A]
AGAGTTCCTTCCTCAATTCCCCATCTCCATCCCATCAAAATTTTCATGTCTCCCAACCAAACAAAACAGGTAATAACCTCATCCTTCTAAACAGGTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of TTC(primary allele)	Frequency of CTC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.20%	32.00%	6.88%	26.87%	T: 0.02%
All Indica	2759	1.20%	46.10%	10.69%	42.04%	T: 0.04%
All Japonica	1512	98.70%	0.80%	0.20%	0.26%	NA
Aus	269	1.10%	63.60%	7.81%	27.51%	NA
Indica I	595	0.80%	31.60%	22.52%	45.04%	NA
Indica II	465	1.50%	41.70%	10.54%	46.24%	NA
Indica III	913	0.50%	60.20%	3.83%	35.27%	T: 0.11%
Indica Intermediate	786	1.90%	43.10%	9.80%	45.17%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	1.00%	0.40%	0.60%	NA
Japonica Intermediate	241	97.90%	1.20%	0.41%	0.41%	NA
VI/Aromatic	96	56.20%	40.60%	1.04%	2.08%	NA
Intermediate	90	37.80%	23.30%	5.56%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523014690	TTC -> T	LOC_Os05g39250.1	upstream_gene_variant ; 337.0bp to feature; MODIFIER	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N
vg0523014690	TTC -> T	LOC_Os05g39240.1	downstream_gene_variant ; 1258.0bp to feature; MODIFIER	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N
vg0523014690	TTC -> T	LOC_Os05g39250-LOC_Os05g39260	intergenic_region ; MODIFIER	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N
vg0523014690	TTC -> DEL	N	N	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N
vg0523014690	TTC -> CTC	LOC_Os05g39250.1	upstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N
vg0523014690	TTC -> CTC	LOC_Os05g39240.1	downstream_gene_variant ; 1257.0bp to feature; MODIFIER	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N
vg0523014690	TTC -> CTC	LOC_Os05g39250-LOC_Os05g39260	intergenic_region ; MODIFIER	silent_mutation	Average:91.708; most accessible tissue: Minghui63 panicle, score: 98.35	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0523014690	TTC	CTC	0.0	-0.01	-0.02	0.0	0.0	-0.01
vg0523014690	TTC	T	0.05	-0.01	-0.1	-0.04	-0.03	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523014690	NA	1.72E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0523014690	NA	9.28E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.58E-43	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.80E-43	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.06E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.40E-51	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	8.13E-20	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.80E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.60E-32	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.62E-34	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.77E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	7.04E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	7.26E-54	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.87E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.04E-35	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.68E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.71E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	7.52E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	9.84E-23	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	5.09E-57	mr1480_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.93E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	5.57E-15	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.35E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	7.06E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.57E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.53E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.59E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.68E-83	mr1711_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	7.15E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	6.99E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	9.82E-17	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.56E-21	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.98E-17	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.03E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.82E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	5.59E-16	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.46E-34	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	4.64E-67	mr1896_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	6.77E-94	mr1907_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.38E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	5.49E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	1.81E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.76E-90	mr1934_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	7.18E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	3.50E-22	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523014690	NA	2.25E-14	mr1986_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251