| Variant ID: vg0522983676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22983676 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGACGGAGGAAGTAATTGGTTGTAAGACATAATACTCTAATCTAAACAGAGATATCTCTAAATTTGTAGTATTAGGATTTGTCATATCCAATTTTTTTC[C/T]
GTCATGTTTGGTAGAATAGATCCGTGGTACTTTCCGTATGCGGTTCGTATGCTCTACCATAATAACATTATCATTATTATAAACACTGATACGCGAGATA
TATCTCGCGTATCAGTGTTTATAATAATGATAATGTTATTATGGTAGAGCATACGAACCGCATACGGAAAGTACCACGGATCTATTCTACCAAACATGAC[G/A]
GAAAAAAATTGGATATGACAAATCCTAATACTACAAATTTAGAGATATCTCTGTTTAGATTAGAGTATTATGTCTTACAACCAATTACTTCCTCCGTCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 3.20% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.50% | 0.40% | 0.00% | NA |
| Aus | 269 | 63.60% | 36.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.50% | 2.70% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522983676 | C -> T | LOC_Os05g39200.1 | upstream_gene_variant ; 377.0bp to feature; MODIFIER | silent_mutation | Average:75.824; most accessible tissue: Callus, score: 99.797 | N | N | N | N |
| vg0522983676 | C -> T | LOC_Os05g39210.1 | upstream_gene_variant ; 4554.0bp to feature; MODIFIER | silent_mutation | Average:75.824; most accessible tissue: Callus, score: 99.797 | N | N | N | N |
| vg0522983676 | C -> T | LOC_Os05g39190.1 | downstream_gene_variant ; 1521.0bp to feature; MODIFIER | silent_mutation | Average:75.824; most accessible tissue: Callus, score: 99.797 | N | N | N | N |
| vg0522983676 | C -> T | LOC_Os05g39190-LOC_Os05g39200 | intergenic_region ; MODIFIER | silent_mutation | Average:75.824; most accessible tissue: Callus, score: 99.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522983676 | NA | 1.61E-09 | mr1157 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522983676 | NA | 2.90E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522983676 | NA | 7.47E-13 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522983676 | NA | 1.58E-10 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522983676 | NA | 1.59E-07 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |