Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522894702:

Variant ID: vg0522894702 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 22894702
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCTTGTGTGCTTCGCGTAGCTTCTATCGTTCCGGAGGTTCCCGAAGCATGGTTCGTGGTCGTCGCCGAAGGTTCGGAAGGCCGTTGTCTCTGAGCAAGG[A/C]
AAGTCACATCATCCTTGAGCATATTGAATCCCAGTTTATAAAATTATTTTGATTTAAATTAATGCATTATCGCTTTATTTAAATTCCTGCGTTATCACTG

Reverse complement sequence

CAGTGATAACGCAGGAATTTAAATAAAGCGATAATGCATTAATTTAAATCAAAATAATTTTATAAACTGGGATTCAATATGCTCAAGGATGATGTGACTT[T/G]
CCTTGCTCAGAGACAACGGCCTTCCGAACCTTCGGCGACGACCACGAACCATGCTTCGGGAACCTCCGGAACGATAGAAGCTACGCGAAGCACACAAGCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.80%	2.90%	6.28%	55.01%	NA
All Indica	2759	3.30%	0.10%	9.93%	86.66%	NA
All Japonica	1512	98.90%	0.10%	0.00%	0.99%	NA
Aus	269	1.90%	36.80%	6.32%	55.02%	NA
Indica I	595	2.00%	0.00%	2.18%	95.80%	NA
Indica II	465	4.50%	0.00%	7.53%	87.96%	NA
Indica III	913	2.70%	0.00%	17.31%	79.96%	NA
Indica Intermediate	786	4.20%	0.40%	8.65%	86.77%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	98.00%	0.00%	0.00%	1.98%	NA
Japonica Intermediate	241	97.90%	0.80%	0.00%	1.24%	NA
VI/Aromatic	96	68.80%	27.10%	0.00%	4.17%	NA
Intermediate	90	38.90%	7.80%	6.67%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0522894702	A -> DEL	N	N	silent_mutation	Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132	N	N	N	N
vg0522894702	A -> C	LOC_Os05g39030.1	downstream_gene_variant ; 4222.0bp to feature; MODIFIER	silent_mutation	Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132	N	N	N	N
vg0522894702	A -> C	LOC_Os05g39040.1	downstream_gene_variant ; 1510.0bp to feature; MODIFIER	silent_mutation	Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132	N	N	N	N
vg0522894702	A -> C	LOC_Os05g39030-LOC_Os05g39040	intergenic_region ; MODIFIER	silent_mutation	Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0522894702	NA	5.77E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702	3.10E-07	1.33E-13	mr1499	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702	NA	1.73E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702	NA	4.89E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702	NA	1.32E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702	NA	7.27E-06	mr1465_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702	NA	4.42E-09	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251