\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522894702:

Variant ID: vg0522894702 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22894702
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTGTGTGCTTCGCGTAGCTTCTATCGTTCCGGAGGTTCCCGAAGCATGGTTCGTGGTCGTCGCCGAAGGTTCGGAAGGCCGTTGTCTCTGAGCAAGG[A/C]
AAGTCACATCATCCTTGAGCATATTGAATCCCAGTTTATAAAATTATTTTGATTTAAATTAATGCATTATCGCTTTATTTAAATTCCTGCGTTATCACTG

Reverse complement sequence

CAGTGATAACGCAGGAATTTAAATAAAGCGATAATGCATTAATTTAAATCAAAATAATTTTATAAACTGGGATTCAATATGCTCAAGGATGATGTGACTT[T/G]
CCTTGCTCAGAGACAACGGCCTTCCGAACCTTCGGCGACGACCACGAACCATGCTTCGGGAACCTCCGGAACGATAGAAGCTACGCGAAGCACACAAGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 2.90% 6.28% 55.01% NA
All Indica  2759 3.30% 0.10% 9.93% 86.66% NA
All Japonica  1512 98.90% 0.10% 0.00% 0.99% NA
Aus  269 1.90% 36.80% 6.32% 55.02% NA
Indica I  595 2.00% 0.00% 2.18% 95.80% NA
Indica II  465 4.50% 0.00% 7.53% 87.96% NA
Indica III  913 2.70% 0.00% 17.31% 79.96% NA
Indica Intermediate  786 4.20% 0.40% 8.65% 86.77% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 98.00% 0.00% 0.00% 1.98% NA
Japonica Intermediate  241 97.90% 0.80% 0.00% 1.24% NA
VI/Aromatic  96 68.80% 27.10% 0.00% 4.17% NA
Intermediate  90 38.90% 7.80% 6.67% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522894702 A -> DEL N N silent_mutation Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N
vg0522894702 A -> C LOC_Os05g39030.1 downstream_gene_variant ; 4222.0bp to feature; MODIFIER silent_mutation Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N
vg0522894702 A -> C LOC_Os05g39040.1 downstream_gene_variant ; 1510.0bp to feature; MODIFIER silent_mutation Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N
vg0522894702 A -> C LOC_Os05g39030-LOC_Os05g39040 intergenic_region ; MODIFIER silent_mutation Average:10.203; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522894702 NA 5.77E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702 3.10E-07 1.33E-13 mr1499 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702 NA 1.73E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702 NA 4.89E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702 NA 1.32E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702 NA 7.27E-06 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522894702 NA 4.42E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251