\
| Variant ID: vg0522752497 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22752497 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.05, others allele: 0.00, population size: 82. )
GCTAGCCGTACCACACCGTGAACGGCGCGTGCCAGGCGGCGAAGCTGAACCAGAGCGCGGTCAGCATCGCGGGCTACCGGAACGTGACACCAGCAGCGAG[C/G]
CCGACCTGGCGAGGGCTGTGGCGGCGCAGCCGGTGTTCGTCATCGTCGACGCCGGCAACTTCATGTTCCAGCTCTACGGCAGCGGTGTCTACACGGGGCC
GGCCCCGTGTAGACACCGCTGCCGTAGAGCTGGAACATGAAGTTGCCGGCGTCGACGATGACGAACACCGGCTGCGCCGCCACAGCCCTCGCCAGGTCGG[G/C]
CTCGCTGCTGGTGTCACGTTCCGGTAGCCCGCGATGCTGACCGCGCTCTGGTTCAGCTTCGCCGCCTGGCACGCGCCGTTCACGGTGTGGTACGGCTAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 10.30% | 5.27% | 1.27% | NA |
| All Indica | 2759 | 73.80% | 15.90% | 8.16% | 2.10% | NA |
| All Japonica | 1512 | 96.80% | 2.80% | 0.26% | 0.07% | NA |
| Aus | 269 | 91.80% | 0.70% | 7.06% | 0.37% | NA |
| Indica I | 595 | 55.00% | 33.30% | 10.42% | 1.34% | NA |
| Indica II | 465 | 78.90% | 8.60% | 9.46% | 3.01% | NA |
| Indica III | 913 | 78.80% | 13.70% | 5.37% | 2.19% | NA |
| Indica Intermediate | 786 | 79.30% | 9.80% | 8.91% | 2.04% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.50% | 8.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522752497 | C -> DEL | LOC_Os05g38780.1 | N | frameshift_variant | Average:75.137; most accessible tissue: Minghui63 young leaf, score: 90.17 | N | N | N | N |
| vg0522752497 | C -> G | LOC_Os05g38780.1 | missense_variant ; p.Pro190Ala; MODERATE | nonsynonymous_codon ; P190G | Average:75.137; most accessible tissue: Minghui63 young leaf, score: 90.17 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0522752497 | C -> G | LOC_Os05g38780.1 | missense_variant ; p.Pro190Ala; MODERATE | nonsynonymous_codon ; P190A | Average:75.137; most accessible tissue: Minghui63 young leaf, score: 90.17 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522752497 | NA | 9.84E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 4.93E-11 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 6.29E-07 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 3.19E-06 | mr1304 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 9.34E-06 | mr1371 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 3.05E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | 4.73E-06 | 4.75E-06 | mr1421 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | 1.94E-06 | 1.94E-06 | mr1421 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 4.77E-06 | mr1528 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 8.71E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 1.77E-07 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 9.03E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 2.17E-06 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 2.53E-06 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522752497 | NA | 4.89E-07 | mr1737 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |