\
| Variant ID: vg0522735034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22735034 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGTGGGGATGGTGCATGCATTGAGTTTATTGCTAGAGTAAATATAGAATGAGAGAGTTATTAGCTTTTTTTTTGTCTTGGTGTACCTATGGAATATGTA[G/T]
ATTAATTTGGAATGGGGGGAGTATATCGAACTGCAATGTAGCTAGATATCAACCACTTGTTGGAATTAATGAATGGGCCTTAGCCCACTCGAAAATTAAT
ATTAATTTTCGAGTGGGCTAAGGCCCATTCATTAATTCCAACAAGTGGTTGATATCTAGCTACATTGCAGTTCGATATACTCCCCCCATTCCAAATTAAT[C/A]
TACATATTCCATAGGTACACCAAGACAAAAAAAAAGCTAATAACTCTCTCATTCTATATTTACTCTAGCAATAAACTCAATGCATGCACCATCCCCACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 2.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522735034 | G -> T | LOC_Os05g38730.1 | upstream_gene_variant ; 1021.0bp to feature; MODIFIER | silent_mutation | Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0522735034 | G -> T | LOC_Os05g38730.2 | upstream_gene_variant ; 1021.0bp to feature; MODIFIER | silent_mutation | Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0522735034 | G -> T | LOC_Os05g38740.1 | downstream_gene_variant ; 1654.0bp to feature; MODIFIER | silent_mutation | Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0522735034 | G -> T | LOC_Os05g38750.1 | downstream_gene_variant ; 4638.0bp to feature; MODIFIER | silent_mutation | Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0522735034 | G -> T | LOC_Os05g38730-LOC_Os05g38740 | intergenic_region ; MODIFIER | silent_mutation | Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522735034 | NA | 2.04E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 3.42E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 1.61E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | 9.19E-06 | NA | mr1342 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 2.37E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 1.02E-11 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 2.61E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 3.54E-09 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 2.03E-06 | mr1465_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522735034 | NA | 1.59E-10 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |