\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522735034:

Variant ID: vg0522735034 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22735034
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTGGGGATGGTGCATGCATTGAGTTTATTGCTAGAGTAAATATAGAATGAGAGAGTTATTAGCTTTTTTTTTGTCTTGGTGTACCTATGGAATATGTA[G/T]
ATTAATTTGGAATGGGGGGAGTATATCGAACTGCAATGTAGCTAGATATCAACCACTTGTTGGAATTAATGAATGGGCCTTAGCCCACTCGAAAATTAAT

Reverse complement sequence

ATTAATTTTCGAGTGGGCTAAGGCCCATTCATTAATTCCAACAAGTGGTTGATATCTAGCTACATTGCAGTTCGATATACTCCCCCCATTCCAAATTAAT[C/A]
TACATATTCCATAGGTACACCAAGACAAAAAAAAAGCTAATAACTCTCTCATTCTATATTTACTCTAGCAATAAACTCAATGCATGCACCATCCCCACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.50% 0.02% 0.00% NA
All Indica  2759 99.80% 0.10% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 66.50% 33.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522735034 G -> T LOC_Os05g38730.1 upstream_gene_variant ; 1021.0bp to feature; MODIFIER silent_mutation Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0522735034 G -> T LOC_Os05g38730.2 upstream_gene_variant ; 1021.0bp to feature; MODIFIER silent_mutation Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0522735034 G -> T LOC_Os05g38740.1 downstream_gene_variant ; 1654.0bp to feature; MODIFIER silent_mutation Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0522735034 G -> T LOC_Os05g38750.1 downstream_gene_variant ; 4638.0bp to feature; MODIFIER silent_mutation Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0522735034 G -> T LOC_Os05g38730-LOC_Os05g38740 intergenic_region ; MODIFIER silent_mutation Average:42.89; most accessible tissue: Minghui63 root, score: 63.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522735034 NA 2.04E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 3.42E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 1.61E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 9.19E-06 NA mr1342 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 2.37E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 1.02E-11 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 2.61E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 3.54E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 2.03E-06 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034 NA 1.59E-10 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251