Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0522735034:

Variant ID: vg0522735034 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 22735034
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTGGGGATGGTGCATGCATTGAGTTTATTGCTAGAGTAAATATAGAATGAGAGAGTTATTAGCTTTTTTTTTGTCTTGGTGTACCTATGGAATATGTA[G/T]
ATTAATTTGGAATGGGGGGAGTATATCGAACTGCAATGTAGCTAGATATCAACCACTTGTTGGAATTAATGAATGGGCCTTAGCCCACTCGAAAATTAAT

Reverse complement sequence

ATTAATTTTCGAGTGGGCTAAGGCCCATTCATTAATTCCAACAAGTGGTTGATATCTAGCTACATTGCAGTTCGATATACTCCCCCCATTCCAAATTAAT[C/A]
TACATATTCCATAGGTACACCAAGACAAAAAAAAAGCTAATAACTCTCTCATTCTATATTTACTCTAGCAATAAACTCAATGCATGCACCATCCCCACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.50%	2.50%	0.02%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0522735034	G -> T	LOC_Os05g38730.1	upstream_gene_variant ; 1021.0bp to feature; MODIFIER	silent_mutation	Average:42.89; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0522735034	G -> T	LOC_Os05g38730.2	upstream_gene_variant ; 1021.0bp to feature; MODIFIER	silent_mutation	Average:42.89; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0522735034	G -> T	LOC_Os05g38740.1	downstream_gene_variant ; 1654.0bp to feature; MODIFIER	silent_mutation	Average:42.89; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0522735034	G -> T	LOC_Os05g38750.1	downstream_gene_variant ; 4638.0bp to feature; MODIFIER	silent_mutation	Average:42.89; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0522735034	G -> T	LOC_Os05g38730-LOC_Os05g38740	intergenic_region ; MODIFIER	silent_mutation	Average:42.89; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0522735034	NA	2.04E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	3.42E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	1.61E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	9.19E-06	NA	mr1342	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	2.37E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	1.02E-11	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	2.61E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	3.54E-09	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	2.03E-06	mr1465_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522735034	NA	1.59E-10	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251