Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522716604:

Variant ID: vg0522716604 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22716604
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCCGAGCTGAGAGTAGTTTACGTATCGTTTTGGACAAGAATGATATCAAACTTTAAAGTTTTGGACAAGAATGATATCAAACTTTAAAATCTTTG[A/G]
TTATGAAAATTTTCTAAAATATTTGTCTTTAAACTATGGTGACTATATGTATATATTAATCTTAAAAATACTTCAATTAAATTATATATTTGTTAACATT

Reverse complement sequence

AATGTTAACAAATATATAATTTAATTGAAGTATTTTTAAGATTAATATATACATATAGTCACCATAGTTTAAAGACAAATATTTTAGAAAATTTTCATAA[T/C]
CAAAGATTTTAAAGTTTGATATCATTCTTGTCCAAAACTTTAAAGTTTGATATCATTCTTGTCCAAAACGATACGTAAACTACTCTCAGCTCGGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 15.00% 1.14% 0.00% NA
All Indica  2759 99.70% 0.10% 0.11% 0.00% NA
All Japonica  1512 51.10% 45.60% 3.31% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.40% 0.38% 0.00% NA
Temperate Japonica  767 24.00% 71.60% 4.43% 0.00% NA
Tropical Japonica  504 86.30% 12.30% 1.39% 0.00% NA
Japonica Intermediate  241 63.50% 32.80% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522716604 A -> G LOC_Os05g38710.1 upstream_gene_variant ; 2664.0bp to feature; MODIFIER silent_mutation Average:83.759; most accessible tissue: Zhenshan97 flag leaf, score: 94.15 N N N N
vg0522716604 A -> G LOC_Os05g38720.1 upstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:83.759; most accessible tissue: Zhenshan97 flag leaf, score: 94.15 N N N N
vg0522716604 A -> G LOC_Os05g38710.3 upstream_gene_variant ; 2664.0bp to feature; MODIFIER silent_mutation Average:83.759; most accessible tissue: Zhenshan97 flag leaf, score: 94.15 N N N N
vg0522716604 A -> G LOC_Os05g38710.2 upstream_gene_variant ; 2664.0bp to feature; MODIFIER silent_mutation Average:83.759; most accessible tissue: Zhenshan97 flag leaf, score: 94.15 N N N N
vg0522716604 A -> G LOC_Os05g38710-LOC_Os05g38720 intergenic_region ; MODIFIER silent_mutation Average:83.759; most accessible tissue: Zhenshan97 flag leaf, score: 94.15 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0522716604 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522716604 NA 1.61E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 9.49E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 3.52E-06 NA mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 3.74E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 1.53E-14 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 4.15E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 2.67E-12 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 3.33E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 1.97E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 6.55E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 1.96E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 7.58E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 4.44E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 5.92E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 1.22E-07 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 8.21E-06 NA mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 1.89E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 2.08E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 7.15E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 1.05E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 6.51E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 3.90E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522716604 NA 9.04E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251