\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522597893:

Variant ID: vg0522597893 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22597893
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGATTATAAGTACAAATTTCTTGTATTGCGCAGGAAATAATAAATCATATGTAACATAATTGGACCTGTCGTGTGTCTTAAACAAAGAATGAATGTTA[A/T]
GGCACAGTGCAGATTGTTGCTTAGATATACTATATGTTTTAGGAAGGATCACTTTTGTATGTGTACAGTTCATTGTTTATCATTTTATAATGGTATTATA

Reverse complement sequence

TATAATACCATTATAAAATGATAAACAATGAACTGTACACATACAAAAGTGATCCTTCCTAAAACATATAGTATATCTAAGCAACAATCTGCACTGTGCC[T/A]
TAACATTCATTCTTTGTTTAAGACACACGACAGGTCCAATTATGTTACATATGATTTATTATTTCCTGCGCAATACAAGAAATTTGTACTTATAATCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.50% 0.28% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.50% 7.60% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 75.60% 22.20% 2.18% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522597893 A -> T LOC_Os05g38510.1 downstream_gene_variant ; 1724.0bp to feature; MODIFIER silent_mutation Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0522597893 A -> T LOC_Os05g38530.1 downstream_gene_variant ; 1462.0bp to feature; MODIFIER silent_mutation Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0522597893 A -> T LOC_Os05g38520.3 downstream_gene_variant ; 271.0bp to feature; MODIFIER silent_mutation Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0522597893 A -> T LOC_Os05g38520.1 intron_variant ; MODIFIER silent_mutation Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0522597893 A -> T LOC_Os05g38520.2 intron_variant ; MODIFIER silent_mutation Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0522597893 A -> T LOC_Os05g38520.4 intron_variant ; MODIFIER silent_mutation Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522597893 NA 6.08E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522597893 3.65E-06 3.65E-06 mr1848 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522597893 NA 5.97E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251