\
| Variant ID: vg0522597893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22597893 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )
TGTGATTATAAGTACAAATTTCTTGTATTGCGCAGGAAATAATAAATCATATGTAACATAATTGGACCTGTCGTGTGTCTTAAACAAAGAATGAATGTTA[A/T]
GGCACAGTGCAGATTGTTGCTTAGATATACTATATGTTTTAGGAAGGATCACTTTTGTATGTGTACAGTTCATTGTTTATCATTTTATAATGGTATTATA
TATAATACCATTATAAAATGATAAACAATGAACTGTACACATACAAAAGTGATCCTTCCTAAAACATATAGTATATCTAAGCAACAATCTGCACTGTGCC[T/A]
TAACATTCATTCTTTGTTTAAGACACACGACAGGTCCAATTATGTTACATATGATTTATTATTTCCTGCGCAATACAAGAAATTTGTACTTATAATCACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 2.50% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.50% | 7.60% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 75.60% | 22.20% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522597893 | A -> T | LOC_Os05g38510.1 | downstream_gene_variant ; 1724.0bp to feature; MODIFIER | silent_mutation | Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0522597893 | A -> T | LOC_Os05g38530.1 | downstream_gene_variant ; 1462.0bp to feature; MODIFIER | silent_mutation | Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0522597893 | A -> T | LOC_Os05g38520.3 | downstream_gene_variant ; 271.0bp to feature; MODIFIER | silent_mutation | Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0522597893 | A -> T | LOC_Os05g38520.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0522597893 | A -> T | LOC_Os05g38520.2 | intron_variant ; MODIFIER | silent_mutation | Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0522597893 | A -> T | LOC_Os05g38520.4 | intron_variant ; MODIFIER | silent_mutation | Average:54.291; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522597893 | NA | 6.08E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522597893 | 3.65E-06 | 3.65E-06 | mr1848 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522597893 | NA | 5.97E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |