Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0522579477:

Variant ID: vg0522579477 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22579477
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCATGTTTTTGAGAAGTTAGATGAGTTATATTCTAGTTATACTCCAGTTACACCCTAGATATAATGTAACTACAGTGTAACTGCATTGTAACTACATT[G/T,A]
TAACTACTATGTAACTAAAATATAACAACATTATCATCTCTATATAATTTAGATATATTGTTACATATATTATTTTAATATTTATATATGAGTTACATTA

Reverse complement sequence

TAATGTAACTCATATATAAATATTAAAATAATATATGTAACAATATATCTAAATTATATAGAGATGATAATGTTGTTATATTTTAGTTACATAGTAGTTA[C/A,T]
AATGTAGTTACAATGCAGTTACACTGTAGTTACATTATATCTAGGGTGTAACTGGAGTATAACTAGAATATAACTCATCTAACTTCTCAAAAACATGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 12.80% 0.34% 0.00% A: 0.02%
All Indica  2759 99.70% 0.30% 0.00% 0.00% A: 0.04%
All Japonica  1512 60.90% 38.10% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.00% 0.00% A: 0.13%
Temperate Japonica  767 94.90% 4.80% 0.26% 0.00% NA
Tropical Japonica  504 15.10% 83.30% 1.59% 0.00% NA
Japonica Intermediate  241 48.50% 49.40% 2.07% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522579477 G -> T LOC_Os05g38490.1 upstream_gene_variant ; 860.0bp to feature; MODIFIER silent_mutation Average:79.112; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0522579477 G -> T LOC_Os05g38480.1 downstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:79.112; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0522579477 G -> T LOC_Os05g38480-LOC_Os05g38490 intergenic_region ; MODIFIER silent_mutation Average:79.112; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0522579477 G -> A LOC_Os05g38490.1 upstream_gene_variant ; 860.0bp to feature; MODIFIER silent_mutation Average:79.112; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0522579477 G -> A LOC_Os05g38480.1 downstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:79.112; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0522579477 G -> A LOC_Os05g38480-LOC_Os05g38490 intergenic_region ; MODIFIER silent_mutation Average:79.112; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0522579477 G A 0.01 0.01 0.02 -0.01 0.0 0.01
vg0522579477 G T 0.0 0.0 0.0 -0.04 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522579477 NA 4.36E-18 mr1449 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.40E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.66E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.78E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 4.67E-32 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 5.07E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 2.85E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 3.77E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 3.74E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 8.63E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 4.35E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 8.73E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 3.65E-08 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.50E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 7.89E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.36E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 4.14E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 5.91E-07 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 2.67E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.01E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 2.06E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 5.71E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 5.73E-14 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 8.17E-07 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 6.74E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.06E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 1.95E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 6.79E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 2.24E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 2.09E-21 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 4.35E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522579477 NA 2.82E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251