\
| Variant ID: vg0522563253 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 22563253 |
| Reference Allele: TCC | Alternative Allele: TC,CCC,TCCC,TCCCCC,TCCCC,T |
| Primary Allele: TC | Secondary Allele: TCC |
Inferred Ancestral Allele: Not determined.
CTCTAGGTGTCAAAGCTTACTAGTACAGTTATATTCCTTGTCCAATTGTATCAATCCCAATGTTTCTTTTGGTCAACCGACATTGGAAGGTTGTGTTCTT[TCC/TC,CCC,TCCC,TCCCCC,TCCCC,T]
CCCCCCTCCTTTCCCAACTTATCTTCCATATTTTTCACGCGCACACTTCACAAACCACTGAACGGTGTATTTTTTGCAAAAAAAAAAGTAGGAAAGTTGC
GCAACTTTCCTACTTTTTTTTTTGCAAAAAATACACCGTTCAGTGGTTTGTGAAGTGTGCGCGTGAAAAATATGGAAGATAAGTTGGGAAAGGAGGGGGG[GGA/GA,GGG,GGGA,GGGGGA,GGGGA,A]
AAGAACACAACCTTCCAATGTCGGTTGACCAAAAGAAACATTGGGATTGATACAATTGGACAAGGAATATAACTGTACTAGTAAGCTTTGACACCTAGAG
| Populations | Population Size | Frequency of TC(primary allele) | Frequency of TCC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 30.50% | 4.15% | 0.00% | CCC: 5.86%; TCCC: 1.67%; TCCCC: 0.66%; TCCCCC: 0.21%; T: 0.08% |
| All Indica | 2759 | 85.40% | 4.30% | 0.33% | 0.00% | CCC: 9.60%; TCCC: 0.14%; T: 0.14%; TCCCCC: 0.04%; TCCCC: 0.04% |
| All Japonica | 1512 | 1.20% | 81.40% | 11.24% | 0.00% | TCCC: 3.37%; TCCCC: 1.79%; CCC: 0.53%; TCCCCC: 0.46% |
| Aus | 269 | 95.90% | 2.60% | 1.12% | 0.00% | TCCCC: 0.37% |
| Indica I | 595 | 65.00% | 1.20% | 0.17% | 0.00% | CCC: 33.28%; TCCC: 0.34% |
| Indica II | 465 | 92.50% | 4.90% | 1.08% | 0.00% | CCC: 1.29%; T: 0.22% |
| Indica III | 913 | 94.20% | 4.10% | 0.00% | 0.00% | CCC: 1.64%; TCCC: 0.11% |
| Indica Intermediate | 786 | 86.50% | 6.50% | 0.38% | 0.00% | CCC: 5.85%; T: 0.38%; TCCCC: 0.13%; TCCCCC: 0.13%; TCCC: 0.13% |
| Temperate Japonica | 767 | 0.70% | 78.60% | 16.82% | 0.00% | TCCCC: 1.56%; TCCC: 1.43%; TCCCCC: 0.65%; CCC: 0.26% |
| Tropical Japonica | 504 | 1.40% | 86.50% | 3.17% | 0.00% | TCCC: 6.15%; TCCCC: 2.38%; CCC: 0.40% |
| Japonica Intermediate | 241 | 2.50% | 79.70% | 10.37% | 0.00% | TCCC: 3.73%; CCC: 1.66%; TCCCC: 1.24%; TCCCCC: 0.83% |
| VI/Aromatic | 96 | 9.40% | 57.30% | 9.38% | 0.00% | TCCC: 19.79%; TCCCCC: 2.08%; TCCCC: 2.08% |
| Intermediate | 90 | 50.00% | 34.40% | 5.56% | 0.00% | TCCC: 5.56%; CCC: 4.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522563253 | TCC -> TCCCC | LOC_Os05g38460.1 | upstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCC | LOC_Os05g38470.1 | upstream_gene_variant ; 4793.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCC | LOC_Os05g38470.2 | upstream_gene_variant ; 2974.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCC | LOC_Os05g38460-LOC_Os05g38470 | intergenic_region ; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> T | LOC_Os05g38460.1 | upstream_gene_variant ; 2187.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> T | LOC_Os05g38470.1 | upstream_gene_variant ; 4795.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> T | LOC_Os05g38470.2 | upstream_gene_variant ; 2976.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> T | LOC_Os05g38460-LOC_Os05g38470 | intergenic_region ; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCCC | LOC_Os05g38460.1 | upstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCCC | LOC_Os05g38470.1 | upstream_gene_variant ; 4793.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCCC | LOC_Os05g38470.2 | upstream_gene_variant ; 2974.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCCCC | LOC_Os05g38460-LOC_Os05g38470 | intergenic_region ; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCC | LOC_Os05g38460.1 | upstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCC | LOC_Os05g38470.1 | upstream_gene_variant ; 4793.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCC | LOC_Os05g38470.2 | upstream_gene_variant ; 2974.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TCCC | LOC_Os05g38460-LOC_Os05g38470 | intergenic_region ; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> CCC | LOC_Os05g38460.1 | upstream_gene_variant ; 2186.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> CCC | LOC_Os05g38470.1 | upstream_gene_variant ; 4796.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> CCC | LOC_Os05g38470.2 | upstream_gene_variant ; 2977.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> CCC | LOC_Os05g38460-LOC_Os05g38470 | intergenic_region ; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TC | LOC_Os05g38460.1 | upstream_gene_variant ; 2188.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TC | LOC_Os05g38470.1 | upstream_gene_variant ; 4794.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TC | LOC_Os05g38470.2 | upstream_gene_variant ; 2975.0bp to feature; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg0522563253 | TCC -> TC | LOC_Os05g38460-LOC_Os05g38470 | intergenic_region ; MODIFIER | silent_mutation | Average:30.844; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522563253 | NA | 2.92E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 5.24E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 9.08E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 1.49E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 5.29E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 1.53E-06 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 6.46E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 9.54E-06 | mr1558_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522563253 | NA | 2.73E-10 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |