\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522563253:

Variant ID: vg0522563253 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 22563253
Reference Allele: TCCAlternative Allele: TC,CCC,TCCC,TCCCCC,TCCCC,T
Primary Allele: TCSecondary Allele: TCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTAGGTGTCAAAGCTTACTAGTACAGTTATATTCCTTGTCCAATTGTATCAATCCCAATGTTTCTTTTGGTCAACCGACATTGGAAGGTTGTGTTCTT[TCC/TC,CCC,TCCC,TCCCCC,TCCCC,T]
CCCCCCTCCTTTCCCAACTTATCTTCCATATTTTTCACGCGCACACTTCACAAACCACTGAACGGTGTATTTTTTGCAAAAAAAAAAGTAGGAAAGTTGC

Reverse complement sequence

GCAACTTTCCTACTTTTTTTTTTGCAAAAAATACACCGTTCAGTGGTTTGTGAAGTGTGCGCGTGAAAAATATGGAAGATAAGTTGGGAAAGGAGGGGGG[GGA/GA,GGG,GGGA,GGGGGA,GGGGA,A]
AAGAACACAACCTTCCAATGTCGGTTGACCAAAAGAAACATTGGGATTGATACAATTGGACAAGGAATATAACTGTACTAGTAAGCTTTGACACCTAGAG

Allele Frequencies:

Populations Population SizeFrequency of TC(primary allele) Frequency of TCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 30.50% 4.15% 0.00% CCC: 5.86%; TCCC: 1.67%; TCCCC: 0.66%; TCCCCC: 0.21%; T: 0.08%
All Indica  2759 85.40% 4.30% 0.33% 0.00% CCC: 9.60%; TCCC: 0.14%; T: 0.14%; TCCCCC: 0.04%; TCCCC: 0.04%
All Japonica  1512 1.20% 81.40% 11.24% 0.00% TCCC: 3.37%; TCCCC: 1.79%; CCC: 0.53%; TCCCCC: 0.46%
Aus  269 95.90% 2.60% 1.12% 0.00% TCCCC: 0.37%
Indica I  595 65.00% 1.20% 0.17% 0.00% CCC: 33.28%; TCCC: 0.34%
Indica II  465 92.50% 4.90% 1.08% 0.00% CCC: 1.29%; T: 0.22%
Indica III  913 94.20% 4.10% 0.00% 0.00% CCC: 1.64%; TCCC: 0.11%
Indica Intermediate  786 86.50% 6.50% 0.38% 0.00% CCC: 5.85%; T: 0.38%; TCCCC: 0.13%; TCCCCC: 0.13%; TCCC: 0.13%
Temperate Japonica  767 0.70% 78.60% 16.82% 0.00% TCCCC: 1.56%; TCCC: 1.43%; TCCCCC: 0.65%; CCC: 0.26%
Tropical Japonica  504 1.40% 86.50% 3.17% 0.00% TCCC: 6.15%; TCCCC: 2.38%; CCC: 0.40%
Japonica Intermediate  241 2.50% 79.70% 10.37% 0.00% TCCC: 3.73%; CCC: 1.66%; TCCCC: 1.24%; TCCCCC: 0.83%
VI/Aromatic  96 9.40% 57.30% 9.38% 0.00% TCCC: 19.79%; TCCCCC: 2.08%; TCCCC: 2.08%
Intermediate  90 50.00% 34.40% 5.56% 0.00% TCCC: 5.56%; CCC: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522563253 TCC -> TCCCC LOC_Os05g38460.1 upstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCC LOC_Os05g38470.1 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCC LOC_Os05g38470.2 upstream_gene_variant ; 2974.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCC LOC_Os05g38460-LOC_Os05g38470 intergenic_region ; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> T LOC_Os05g38460.1 upstream_gene_variant ; 2187.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> T LOC_Os05g38470.1 upstream_gene_variant ; 4795.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> T LOC_Os05g38470.2 upstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> T LOC_Os05g38460-LOC_Os05g38470 intergenic_region ; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCCC LOC_Os05g38460.1 upstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCCC LOC_Os05g38470.1 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCCC LOC_Os05g38470.2 upstream_gene_variant ; 2974.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCCCC LOC_Os05g38460-LOC_Os05g38470 intergenic_region ; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCC LOC_Os05g38460.1 upstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCC LOC_Os05g38470.1 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCC LOC_Os05g38470.2 upstream_gene_variant ; 2974.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TCCC LOC_Os05g38460-LOC_Os05g38470 intergenic_region ; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> CCC LOC_Os05g38460.1 upstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> CCC LOC_Os05g38470.1 upstream_gene_variant ; 4796.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> CCC LOC_Os05g38470.2 upstream_gene_variant ; 2977.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> CCC LOC_Os05g38460-LOC_Os05g38470 intergenic_region ; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TC LOC_Os05g38460.1 upstream_gene_variant ; 2188.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TC LOC_Os05g38470.1 upstream_gene_variant ; 4794.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TC LOC_Os05g38470.2 upstream_gene_variant ; 2975.0bp to feature; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N
vg0522563253 TCC -> TC LOC_Os05g38460-LOC_Os05g38470 intergenic_region ; MODIFIER silent_mutation Average:30.844; most accessible tissue: Callus, score: 47.902 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522563253 NA 2.92E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 5.24E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 9.08E-09 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 1.49E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 5.29E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 1.53E-06 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 6.46E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 9.54E-06 mr1558_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522563253 NA 2.73E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251